Incidental Mutation 'R3610:Tars'
List |< first << previous [record 15 of 20] next >> last >|
ID269210
Institutional Source Beutler Lab
Gene Symbol Tars
Ensembl Gene ENSMUSG00000022241
Gene Namethreonyl-tRNA synthetase
SynonymsD15Wsu59e, ThrRS
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11382301-11399665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11392904 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 152 (Y152C)
Ref Sequence ENSEMBL: ENSMUSP00000022849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022849] [ENSMUST00000228814]
Predicted Effect probably damaging
Transcript: ENSMUST00000022849
AA Change: Y152C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022849
Gene: ENSMUSG00000022241
AA Change: Y152C

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Pfam:TGS 82 142 7.5e-18 PFAM
tRNA_SAD 248 297 1.91e-16 SMART
Pfam:tRNA-synt_2b 396 607 5e-38 PFAM
Pfam:HGTP_anticodon 619 710 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228207
Predicted Effect probably benign
Transcript: ENSMUST00000228814
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Threonyl-tRNA synthetase belongs to the class-II aminoacyl-tRNA synthetase family [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Tars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Tars APN 15 11388221 splice site probably null
IGL00642:Tars APN 15 11394372 missense probably damaging 1.00
IGL01315:Tars APN 15 11389734 nonsense probably null
IGL01459:Tars APN 15 11391854 missense possibly damaging 0.76
IGL02141:Tars APN 15 11391194 missense probably damaging 0.96
IGL03292:Tars APN 15 11384021 missense probably benign 0.22
R0383:Tars UTSW 15 11390325 missense probably benign
R0517:Tars UTSW 15 11394366 nonsense probably null
R0685:Tars UTSW 15 11385173 missense probably benign
R1589:Tars UTSW 15 11388175 missense probably benign 0.32
R1753:Tars UTSW 15 11394243 nonsense probably null
R2051:Tars UTSW 15 11393194 nonsense probably null
R2060:Tars UTSW 15 11394373 missense probably benign 0.03
R2216:Tars UTSW 15 11389708 missense probably benign 0.00
R4656:Tars UTSW 15 11394264 missense probably damaging 1.00
R4844:Tars UTSW 15 11385195 missense possibly damaging 0.85
R4974:Tars UTSW 15 11390391 missense probably damaging 1.00
R5551:Tars UTSW 15 11391982 missense probably damaging 0.97
R5992:Tars UTSW 15 11397196 missense probably damaging 1.00
R6742:Tars UTSW 15 11394341 missense probably damaging 0.98
R6778:Tars UTSW 15 11389699 missense probably benign 0.06
R6850:Tars UTSW 15 11392799 missense probably benign
R7270:Tars UTSW 15 11392019 missense probably benign 0.00
R7401:Tars UTSW 15 11392009 nonsense probably null
Z1088:Tars UTSW 15 11391884 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGACAGTGCTTTAAAGGAAACACAC -3'
(R):5'- TGGACCGTGAGCTGCATAAG -3'

Sequencing Primer
(F):5'- CAGAACTAGACCCGGAGCCATG -3'
(R):5'- ACGAGCTAGTCTGCGTCGTG -3'
Posted On2015-02-19