Incidental Mutation 'R3610:Rcl1'
List |< first << previous [record 11 of 20] next >> last >|
ID269215
Institutional Source Beutler Lab
Gene Symbol Rcl1
Ensembl Gene ENSMUSG00000024785
Gene NameRNA terminal phosphate cyclase-like 1
Synonyms2310040A02Rik, Rnac, RPCL1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R3610 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29101375-29143843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29118230 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 72 (T72A)
Ref Sequence ENSEMBL: ENSMUSP00000067579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064393]
Predicted Effect probably benign
Transcript: ENSMUST00000064393
AA Change: T72A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067579
Gene: ENSMUSG00000024785
AA Change: T72A

DomainStartEndE-ValueType
Pfam:RTC 8 341 1.3e-61 PFAM
Pfam:RTC_insert 184 289 1.8e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Rcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Rcl1 APN 19 29121262 splice site probably null
IGL01514:Rcl1 APN 19 29143298 utr 3 prime probably benign
IGL02625:Rcl1 APN 19 29118341 missense probably benign 0.04
R0512:Rcl1 UTSW 19 29128097 missense probably damaging 1.00
R2249:Rcl1 UTSW 19 29121868 missense possibly damaging 0.46
R4415:Rcl1 UTSW 19 29118362 missense probably benign 0.01
R5324:Rcl1 UTSW 19 29128001 missense probably benign 0.23
R5679:Rcl1 UTSW 19 29121258 splice site probably null
R5988:Rcl1 UTSW 19 29121767 missense probably damaging 1.00
R7332:Rcl1 UTSW 19 29130696 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCAGAGGCTTGGTGTCAG -3'
(R):5'- AACGTCACACTACCGTCTG -3'

Sequencing Primer
(F):5'- CAGTGAGTCAGCTTTTGAGATGAAG -3'
(R):5'- GTCTGACCTCATTACTCACCGAAG -3'
Posted On2015-02-19