Incidental Mutation 'R3611:D1Ertd622e'
ID269217
Institutional Source Beutler Lab
Gene Symbol D1Ertd622e
Ensembl Gene ENSMUSG00000044768
Gene NameDNA segment, Chr 1, ERATO Doi 622, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3611 (G1)
Quality Score199
Status Not validated
Chromosome1
Chromosomal Location97606318-97662074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97646334 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000138031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053033] [ENSMUST00000142234] [ENSMUST00000149927] [ENSMUST00000153115]
Predicted Effect probably damaging
Transcript: ENSMUST00000053033
AA Change: E2G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051034
Gene: ENSMUSG00000044768
AA Change: E2G

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142234
AA Change: E2G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137803
Gene: ENSMUSG00000044768
AA Change: E2G

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 134 1.1e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149927
AA Change: E2G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121997
Gene: ENSMUSG00000044768
AA Change: E2G

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 8.7e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153115
AA Change: E2G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138031
Gene: ENSMUSG00000044768
AA Change: E2G

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 G A 6: 92,869,984 T521M probably benign Het
Ap1b1 A G 11: 5,024,427 K345R possibly damaging Het
Arhgap26 T C 18: 38,933,919 W53R probably benign Het
Brd1 A G 15: 88,700,944 S896P probably benign Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Chd3 A G 11: 69,362,147 S281P possibly damaging Het
Chl1 A G 6: 103,698,155 D601G probably damaging Het
Cntn3 C A 6: 102,208,077 V693L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dsc2 A G 18: 20,032,351 V855A probably damaging Het
Fat2 T C 11: 55,312,069 M60V probably benign Het
Fmnl1 A G 11: 103,194,765 probably benign Het
Gnpda2 A G 5: 69,577,409 S268P probably benign Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Kmt2a A T 9: 44,822,466 probably benign Het
Lsg1 A G 16: 30,561,795 V608A probably benign Het
Mmrn2 G A 14: 34,398,675 V501M probably benign Het
Olfr45 G A 7: 140,691,100 C65Y probably benign Het
Ppa2 A G 3: 133,348,106 T186A probably benign Het
Rims4 T A 2: 163,879,206 I42F possibly damaging Het
Rnf17 A T 14: 56,467,740 E700D probably benign Het
Skor2 T C 18: 76,858,838 V85A unknown Het
Srbd1 T C 17: 86,102,927 T526A probably benign Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Ubtfl1 T C 9: 18,409,365 I63T probably damaging Het
Zfp616 A G 11: 74,083,442 K270R possibly damaging Het
Zfp750 G A 11: 121,512,155 P589L probably benign Het
Zfr G A 15: 12,159,762 probably null Het
Other mutations in D1Ertd622e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:D1Ertd622e APN 1 97646006 missense probably damaging 0.99
IGL02349:D1Ertd622e APN 1 97646052 missense probably damaging 1.00
R0577:D1Ertd622e UTSW 1 97661826 splice site probably null
R1646:D1Ertd622e UTSW 1 97645806 missense probably damaging 0.99
R5270:D1Ertd622e UTSW 1 97645995 missense probably damaging 1.00
R5934:D1Ertd622e UTSW 1 97645930 missense possibly damaging 0.69
R6863:D1Ertd622e UTSW 1 97646305 missense probably benign
R7133:D1Ertd622e UTSW 1 97645920 missense probably benign 0.01
R7911:D1Ertd622e UTSW 1 97645890 missense probably damaging 0.98
R7992:D1Ertd622e UTSW 1 97645890 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGTCCATGTGGAGGATCTG -3'
(R):5'- ATTGAGCTGCCTGTGCGTTC -3'

Sequencing Primer
(F):5'- TCCATGTGGAGGATCTGATAACC -3'
(R):5'- GATGGCAGCGCTCATTTGTTACC -3'
Posted On2015-02-19