Mutagenetix > Incidental Mutations

Incidental Mutation 'R3611:Chl1'

269226

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.412) question?

Stock #

R3611 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103698155 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 601 (D601G)

Ref Sequence

ENSEMBL: ENSMUSP00000145026 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066905
AA Change: D585G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: D585G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203830
AA Change: D585G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: D585G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203912
AA Change: D601G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077
AA Change: D601G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205098

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	G	A	6: 92,869,984	T521M	probably benign	Het
Ap1b1	A	G	11: 5,024,427	K345R	possibly damaging	Het
Arhgap26	T	C	18: 38,933,919	W53R	probably benign	Het
Brd1	A	G	15: 88,700,944	S896P	probably benign	Het
Cc2d2a	A	T	5: 43,712,326	E856D	probably damaging	Het
Chd3	A	G	11: 69,362,147	S281P	possibly damaging	Het
Cntn3	C	A	6: 102,208,077	V693L	possibly damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
D1Ertd622e	T	C	1: 97,646,334	E2G	probably damaging	Het
Dsc2	A	G	18: 20,032,351	V855A	probably damaging	Het
Fat2	T	C	11: 55,312,069	M60V	probably benign	Het
Fmnl1	A	G	11: 103,194,765		probably benign	Het
Gnpda2	A	G	5: 69,577,409	S268P	probably benign	Het
Kif18a	A	C	2: 109,338,596	D833A	probably benign	Het
Kmt2a	A	T	9: 44,822,466		probably benign	Het
Lsg1	A	G	16: 30,561,795	V608A	probably benign	Het
Mmrn2	G	A	14: 34,398,675	V501M	probably benign	Het
Olfr45	G	A	7: 140,691,100	C65Y	probably benign	Het
Ppa2	A	G	3: 133,348,106	T186A	probably benign	Het
Rims4	T	A	2: 163,879,206	I42F	possibly damaging	Het
Rnf17	A	T	14: 56,467,740	E700D	probably benign	Het
Skor2	T	C	18: 76,858,838	V85A	unknown	Het
Srbd1	T	C	17: 86,102,927	T526A	probably benign	Het
Ttn	C	T	2: 76,759,259	R21217H	probably damaging	Het
Ubtfl1	T	C	9: 18,409,365	I63T	probably damaging	Het
Zfp616	A	G	11: 74,083,442	K270R	possibly damaging	Het
Zfp750	G	A	11: 121,512,155	P589L	probably benign	Het
Zfr	G	A	15: 12,159,762		probably null	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	splice site	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6366:Chl1	UTSW	6	103729236	missense	possibly damaging	0.95
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94
R7838:Chl1	UTSW	6	103691674	missense	probably benign	0.01
R7863:Chl1	UTSW	6	103706514	missense	possibly damaging	0.46
R7874:Chl1	UTSW	6	103690263	missense	probably benign	0.22
R7998:Chl1	UTSW	6	103729289	missense	probably benign	0.01
R8044:Chl1	UTSW	6	103706632	missense	probably damaging	0.96
R8059:Chl1	UTSW	6	103674987	missense	probably damaging	0.97
R8462:Chl1	UTSW	6	103729169	missense	probably benign	0.11
Z1177:Chl1	UTSW	6	103693096	nonsense	probably null
Z1177:Chl1	UTSW	6	103697949	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TAACAGCTGCAGGGTATGAAC -3'
(R):5'- GTTCACTCTATGAGCAGAGGC -3'

Sequencing Primer
(F):5'- GGTATGAACCGGTGTCATCACTC -3'
(R):5'- GAGGCTTCACGAATCATTGAC -3'

Posted On

2015-02-19