Incidental Mutation 'R3611:Lsg1'
ID 269241
Institutional Source Beutler Lab
Gene Symbol Lsg1
Ensembl Gene ENSMUSG00000022538
Gene Name large 60S subunit nuclear export GTPase 1
Synonyms D16Bwg1547e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R3611 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 30560494-30587592 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30561795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 608 (V608A)
Ref Sequence ENSEMBL: ENSMUSP00000112860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117363] [ENSMUST00000143170]
AlphaFold Q3UM18
Predicted Effect probably benign
Transcript: ENSMUST00000117363
AA Change: V608A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112860
Gene: ENSMUSG00000022538
AA Change: V608A

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
SCOP:d1h65a_ 165 280 2e-3 SMART
low complexity region 300 309 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:MMR_HSR1 374 461 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150499
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 G A 6: 92,869,984 T521M probably benign Het
Ap1b1 A G 11: 5,024,427 K345R possibly damaging Het
Arhgap26 T C 18: 38,933,919 W53R probably benign Het
Brd1 A G 15: 88,700,944 S896P probably benign Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Chd3 A G 11: 69,362,147 S281P possibly damaging Het
Chl1 A G 6: 103,698,155 D601G probably damaging Het
Cntn3 C A 6: 102,208,077 V693L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
D1Ertd622e T C 1: 97,646,334 E2G probably damaging Het
Dsc2 A G 18: 20,032,351 V855A probably damaging Het
Fat2 T C 11: 55,312,069 M60V probably benign Het
Fmnl1 A G 11: 103,194,765 probably benign Het
Gnpda2 A G 5: 69,577,409 S268P probably benign Het
Kif18a A C 2: 109,338,596 D833A probably benign Het
Kmt2a A T 9: 44,822,466 probably benign Het
Mmrn2 G A 14: 34,398,675 V501M probably benign Het
Olfr45 G A 7: 140,691,100 C65Y probably benign Het
Ppa2 A G 3: 133,348,106 T186A probably benign Het
Rims4 T A 2: 163,879,206 I42F possibly damaging Het
Rnf17 A T 14: 56,467,740 E700D probably benign Het
Skor2 T C 18: 76,858,838 V85A unknown Het
Srbd1 T C 17: 86,102,927 T526A probably benign Het
Ttn C T 2: 76,759,259 R21217H probably damaging Het
Ubtfl1 T C 9: 18,409,365 I63T probably damaging Het
Zfp616 A G 11: 74,083,442 K270R possibly damaging Het
Zfp750 G A 11: 121,512,155 P589L probably benign Het
Zfr G A 15: 12,159,762 probably null Het
Other mutations in Lsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Lsg1 APN 16 30582095 missense probably damaging 1.00
IGL02023:Lsg1 APN 16 30585676 missense probably damaging 1.00
IGL02530:Lsg1 APN 16 30571242 missense probably benign 0.31
IGL02647:Lsg1 APN 16 30585552 critical splice donor site probably null
IGL02710:Lsg1 APN 16 30571474 missense probably benign
IGL02714:Lsg1 APN 16 30585550 splice site probably null
IGL02938:Lsg1 APN 16 30571206 missense probably benign
R1349:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1372:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1569:Lsg1 UTSW 16 30581005 splice site probably null
R1667:Lsg1 UTSW 16 30571352 missense probably damaging 1.00
R2445:Lsg1 UTSW 16 30564695 missense probably benign 0.01
R2991:Lsg1 UTSW 16 30561729 missense probably damaging 0.97
R4256:Lsg1 UTSW 16 30573243 missense probably benign 0.01
R4700:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R4750:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R5114:Lsg1 UTSW 16 30561720 missense probably damaging 1.00
R5580:Lsg1 UTSW 16 30569167 missense probably null 0.91
R5589:Lsg1 UTSW 16 30581001 missense probably damaging 1.00
R5719:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R5721:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R6377:Lsg1 UTSW 16 30574568 missense possibly damaging 0.95
R6899:Lsg1 UTSW 16 30582088 missense probably benign
R7469:Lsg1 UTSW 16 30561817 missense probably benign 0.08
R7530:Lsg1 UTSW 16 30582601 missense possibly damaging 0.65
R7737:Lsg1 UTSW 16 30581185 splice site probably null
R7869:Lsg1 UTSW 16 30564722 missense probably benign 0.00
R8198:Lsg1 UTSW 16 30564776 missense probably benign
R8439:Lsg1 UTSW 16 30561751 missense probably damaging 1.00
R8466:Lsg1 UTSW 16 30582101 missense probably benign 0.00
R8735:Lsg1 UTSW 16 30581047 critical splice acceptor site probably null
X0065:Lsg1 UTSW 16 30571458 missense probably benign
Z1177:Lsg1 UTSW 16 30573289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACTTCTGGTGCGACTG -3'
(R):5'- TACTGTGAAGCCCAGCATG -3'

Sequencing Primer
(F):5'- TCCAGTCCACAGTGCAGTG -3'
(R):5'- CATGAGCTGGTAGGGGTGAGAC -3'
Posted On 2015-02-19