Mutagenetix > Incidental Mutations

Incidental Mutation 'R3612:Slc9a2'

269245

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

040672-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R3612 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 40719058 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

Predicted Effect

probably null
Transcript: ENSMUST00000027231

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000192345

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	C	5: 125,503,187	V192A	probably damaging	Het
Acsm2	G	C	7: 119,591,330	V90L	probably damaging	Het
Adam5	T	C	8: 24,818,089		probably benign	Het
Ankrd12	A	T	17: 65,983,547	D1630E	probably benign	Het
Ccdc88c	A	T	12: 100,939,073	I1085N	probably damaging	Het
Cdc42bpb	A	G	12: 111,303,822		probably benign	Het
Cdh19	A	T	1: 110,893,296	C571S	probably damaging	Het
Cep290	T	A	10: 100,541,581	L1491*	probably null	Het
Cherp	G	A	8: 72,461,996		probably benign	Het
Diaph3	T	C	14: 87,037,457	S188G	probably null	Het
Ech1	C	T	7: 28,830,243	R34C	probably damaging	Het
Erc2	T	C	14: 27,777,177	S337P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fah	A	G	7: 84,585,290	V412A	probably damaging	Het
Gatc	T	A	5: 115,335,486	E131D	probably benign	Het
Glrb	A	G	3: 80,862,030	V130A	possibly damaging	Het
Gm4782	T	A	6: 50,608,630		probably null	Het
Klhl1	C	T	14: 96,381,770		probably null	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myo15	G	C	11: 60,477,679	D422H	probably damaging	Het
Ncapd3	T	A	9: 27,050,357	H360Q	probably damaging	Het
Olfr381	T	C	11: 73,485,940	R295G	probably benign	Het
Ppargc1b	T	C	18: 61,310,556	N528S	probably benign	Het
Rprd2	G	A	3: 95,764,152	P1313L	probably damaging	Het
Slc12a7	C	A	13: 73,809,923	D955E	probably benign	Het
Tex24	T	A	8: 27,345,173	V243D	probably benign	Het
Vmn2r17	A	G	5: 109,429,597	T505A	probably benign	Het
Vps37a	T	C	8: 40,544,936		probably benign	Het
Zmynd19	A	G	2: 24,951,480	Y20C	probably damaging	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTTTGGCCTCAGTGACATC -3'
(R):5'- GAGTTTCAAGATCACATCATAAGCTC -3'

Sequencing Primer
(F):5'- GTGACATCACCCTGCTCCAG -3'
(R):5'- TCCAGCAAGATGTGATCTGC -3'

Posted On

2015-02-19