Mutagenetix > Incidental Mutation

Incidental Mutation 'R3612:Ech1'

269255

Institutional Source

Beutler Lab

Gene Symbol

Ech1

Ensembl Gene

ENSMUSG00000053898

Gene Name

enoyl coenzyme A hydratase 1, peroxisomal

Synonyms

dienoyl-CoA isomerase

MMRRC Submission

040672-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3612 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28524763-28531664 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 28529668 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 34 (R34C)

Ref Sequence

ENSEMBL: ENSMUSP00000116992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066264] [ENSMUST00000066723] [ENSMUST00000132376] [ENSMUST00000208971] [ENSMUST00000151547]

AlphaFold

O35459

Predicted Effect

probably damaging
Transcript: ENSMUST00000066264
AA Change: R184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066092
Gene: ENSMUSG00000053898
AA Change: R184C

Domain	Start	End	E-Value	Type
Pfam:ECH_1	61	321	7.2e-50	PFAM
Pfam:ECH_2	66	258	9.6e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000066723

SMART Domains

Protein: ENSMUSP00000066461
Gene: ENSMUSG00000053964

Domain	Start	End	E-Value	Type
GLECT	17	150	1.24e-59	SMART
Gal-bind_lectin	23	149	1.49e-59	SMART
low complexity region	151	162	N/A	INTRINSIC
GLECT	196	326	1.49e-53	SMART
Gal-bind_lectin	202	326	2.02e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125155

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127093

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127590

Predicted Effect

probably damaging
Transcript: ENSMUST00000132376
AA Change: R34C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116992
Gene: ENSMUSG00000053898
AA Change: R34C

Domain	Start	End	E-Value	Type
Pfam:ECH	26	166	2.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000208971

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154839

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143708

Predicted Effect

probably benign
Transcript: ENSMUST00000151547

SMART Domains

Protein: ENSMUSP00000141005
Gene: ENSMUSG00000053964

Domain	Start	End	E-Value	Type
Gal-bind_lectin	1	109	4e-45	SMART
GLECT	1	110	2.3e-38	SMART
low complexity region	111	122	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (31/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The gene product shows high sequence similarity to enoyl-coenzyme A (CoA) hydratases of several species, particularly within a conserved domain characteristic of these proteins. The encoded protein, which contains a C-terminal peroxisomal targeting sequence, localizes to the peroxisome. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans,5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. This enzyme functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aacs	T	C	5: 125,580,251 (GRCm39)	V192A	probably damaging	Het
Acsm2	G	C	7: 119,190,553 (GRCm39)	V90L	probably damaging	Het
Adam5	T	C	8: 25,308,105 (GRCm39)		probably benign	Het
Ankrd12	A	T	17: 66,290,542 (GRCm39)	D1630E	probably benign	Het
Ccdc88c	A	T	12: 100,905,332 (GRCm39)	I1085N	probably damaging	Het
Cdc42bpb	A	G	12: 111,270,256 (GRCm39)		probably benign	Het
Cdh19	A	T	1: 110,821,026 (GRCm39)	C571S	probably damaging	Het
Cep290	T	A	10: 100,377,443 (GRCm39)	L1491*	probably null	Het
Cherp	G	A	8: 73,215,840 (GRCm39)		probably benign	Het
Diaph3	T	C	14: 87,274,893 (GRCm39)	S188G	probably null	Het
Erc2	T	C	14: 27,499,134 (GRCm39)	S337P	possibly damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fah	A	G	7: 84,234,498 (GRCm39)	V412A	probably damaging	Het
Gatc	T	A	5: 115,473,545 (GRCm39)	E131D	probably benign	Het
Glrb	A	G	3: 80,769,337 (GRCm39)	V130A	possibly damaging	Het
Gm4782	T	A	6: 50,585,610 (GRCm39)		probably null	Het
Klhl1	C	T	14: 96,619,206 (GRCm39)		probably null	Het
Mslnl	G	A	17: 25,961,908 (GRCm39)	V128M	probably damaging	Het
Myo15a	G	C	11: 60,368,505 (GRCm39)	D422H	probably damaging	Het
Ncapd3	T	A	9: 26,961,653 (GRCm39)	H360Q	probably damaging	Het
Or1e22	T	C	11: 73,376,766 (GRCm39)	R295G	probably benign	Het
Ppargc1b	T	C	18: 61,443,627 (GRCm39)	N528S	probably benign	Het
Rprd2	G	A	3: 95,671,464 (GRCm39)	P1313L	probably damaging	Het
Slc12a7	C	A	13: 73,958,042 (GRCm39)	D955E	probably benign	Het
Slc9a2	G	A	1: 40,758,218 (GRCm39)		probably null	Het
Tex24	T	A	8: 27,835,201 (GRCm39)	V243D	probably benign	Het
Vmn2r17	A	G	5: 109,577,463 (GRCm39)	T505A	probably benign	Het
Vps37a	T	C	8: 40,997,977 (GRCm39)		probably benign	Het
Zmynd19	A	G	2: 24,841,492 (GRCm39)	Y20C	probably damaging	Het

Other mutations in Ech1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
pudgy	UTSW	7	28,529,763 (GRCm39)	splice site	probably null
R1640:Ech1	UTSW	7	28,531,264 (GRCm39)	missense	probably damaging	1.00
R1797:Ech1	UTSW	7	28,531,288 (GRCm39)	missense	probably damaging	1.00
R4395:Ech1	UTSW	7	28,525,671 (GRCm39)	missense	probably damaging	1.00
R4698:Ech1	UTSW	7	28,531,478 (GRCm39)	missense	probably benign	0.03
R6217:Ech1	UTSW	7	28,531,261 (GRCm39)	missense	possibly damaging	0.91
R6396:Ech1	UTSW	7	28,529,763 (GRCm39)	splice site	probably null
R6427:Ech1	UTSW	7	28,525,310 (GRCm39)	missense	probably benign	0.00
R6514:Ech1	UTSW	7	28,525,440 (GRCm39)	missense	possibly damaging	0.91
R6681:Ech1	UTSW	7	28,529,763 (GRCm39)	splice site	probably null
R6999:Ech1	UTSW	7	28,529,689 (GRCm39)	missense	probably benign	0.28
R7448:Ech1	UTSW	7	28,525,623 (GRCm39)	missense	probably damaging	1.00
R7544:Ech1	UTSW	7	28,525,392 (GRCm39)	missense	probably benign
R8104:Ech1	UTSW	7	28,524,728 (GRCm39)	unclassified	probably benign
R8334:Ech1	UTSW	7	28,531,248 (GRCm39)	missense	probably benign	0.00
R9195:Ech1	UTSW	7	28,525,446 (GRCm39)	missense	probably damaging	1.00
R9338:Ech1	UTSW	7	28,525,427 (GRCm39)	missense	probably null	0.08

Predicted Primers

PCR Primer
(F):5'- TGATTGCTGCCATTCACGG -3'
(R):5'- TCTGATGGACCTCCTTCTAGG -3'

Sequencing Primer
(F):5'- AGTCTGTAATCAGTGGCCAC -3'
(R):5'- TCCTTCTAGGAAGCCCTCAG -3'

Posted On

2015-02-19