Incidental Mutation 'R3612:Fah'
ID 269256
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms
MMRRC Submission 040672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3612 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 84585159-84606722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84585290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 412 (V412A)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000180387]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032865
AA Change: V412A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: V412A

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180387
Meta Mutation Damage Score 0.8171 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,503,187 V192A probably damaging Het
Acsm2 G C 7: 119,591,330 V90L probably damaging Het
Adam5 T C 8: 24,818,089 probably benign Het
Ankrd12 A T 17: 65,983,547 D1630E probably benign Het
Ccdc88c A T 12: 100,939,073 I1085N probably damaging Het
Cdc42bpb A G 12: 111,303,822 probably benign Het
Cdh19 A T 1: 110,893,296 C571S probably damaging Het
Cep290 T A 10: 100,541,581 L1491* probably null Het
Cherp G A 8: 72,461,996 probably benign Het
Diaph3 T C 14: 87,037,457 S188G probably null Het
Ech1 C T 7: 28,830,243 R34C probably damaging Het
Erc2 T C 14: 27,777,177 S337P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gatc T A 5: 115,335,486 E131D probably benign Het
Glrb A G 3: 80,862,030 V130A possibly damaging Het
Gm4782 T A 6: 50,608,630 probably null Het
Klhl1 C T 14: 96,381,770 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo15 G C 11: 60,477,679 D422H probably damaging Het
Ncapd3 T A 9: 27,050,357 H360Q probably damaging Het
Olfr381 T C 11: 73,485,940 R295G probably benign Het
Ppargc1b T C 18: 61,310,556 N528S probably benign Het
Rprd2 G A 3: 95,764,152 P1313L probably damaging Het
Slc12a7 C A 13: 73,809,923 D955E probably benign Het
Slc9a2 G A 1: 40,719,058 probably null Het
Tex24 T A 8: 27,345,173 V243D probably benign Het
Vmn2r17 A G 5: 109,429,597 T505A probably benign Het
Vps37a T C 8: 40,544,936 probably benign Het
Zmynd19 A G 2: 24,951,480 Y20C probably damaging Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0245:Fah UTSW 7 84595498 missense probably benign
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4386:Fah UTSW 7 84599136 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R6586:Fah UTSW 7 84593260 missense probably benign 0.04
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
R8823:Fah UTSW 7 84605717 missense possibly damaging 0.85
RF002:Fah UTSW 7 84589628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCAGGGCCTTCAGTCTC -3'
(R):5'- TGACATGCAAGCCTACCTC -3'

Sequencing Primer
(F):5'- CTCTATAGGAGCAGCATTCACTG -3'
(R):5'- GCCTACCTCTGGCCTGATTAG -3'
Posted On 2015-02-19