Incidental Mutation 'R3612:Ppargc1b'
ID 269277
Institutional Source Beutler Lab
Gene Symbol Ppargc1b
Ensembl Gene ENSMUSG00000033871
Gene Name peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms PGC-1beta/ERRL1, 4631412G21Rik
MMRRC Submission 040672-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R3612 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 61431207-61533502 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61443627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 528 (N528S)
Ref Sequence ENSEMBL: ENSMUSP00000069431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063307] [ENSMUST00000075299]
AlphaFold Q8VHJ7
Predicted Effect probably benign
Transcript: ENSMUST00000063307
AA Change: N528S

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069431
Gene: ENSMUSG00000033871
AA Change: N528S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 137 156 N/A INTRINSIC
low complexity region 169 189 N/A INTRINSIC
coiled coil region 437 472 N/A INTRINSIC
low complexity region 613 619 N/A INTRINSIC
low complexity region 640 656 N/A INTRINSIC
low complexity region 799 833 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
RRM 910 980 8.87e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075299
AA Change: N512S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074771
Gene: ENSMUSG00000033871
AA Change: N512S

DomainStartEndE-ValueType
low complexity region 91 96 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 153 173 N/A INTRINSIC
coiled coil region 421 456 N/A INTRINSIC
low complexity region 597 603 N/A INTRINSIC
low complexity region 624 640 N/A INTRINSIC
low complexity region 783 817 N/A INTRINSIC
low complexity region 836 856 N/A INTRINSIC
RRM 894 964 8.87e-7 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene stimulates the activity of several transcription factors and nuclear receptors, including estrogen receptor alpha, nuclear respiratory factor 1, and glucocorticoid receptor. The encoded protein may be involved in fat oxidation, non-oxidative glucose metabolism, and the regulation of energy expenditure. This protein is downregulated in prediabetic and type 2 diabetes mellitus patients. Certain allelic variations in this gene increase the risk of the development of obesity. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous inactivation of this gene can lead to postnatal lethality and impaired mitochondrial activity, adaptive thermogenesis, and hepatic function. Homozygotes for a null allele also display a defect in heart rate regulation, reduced body weight and WAT content, and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aacs T C 5: 125,580,251 (GRCm39) V192A probably damaging Het
Acsm2 G C 7: 119,190,553 (GRCm39) V90L probably damaging Het
Adam5 T C 8: 25,308,105 (GRCm39) probably benign Het
Ankrd12 A T 17: 66,290,542 (GRCm39) D1630E probably benign Het
Ccdc88c A T 12: 100,905,332 (GRCm39) I1085N probably damaging Het
Cdc42bpb A G 12: 111,270,256 (GRCm39) probably benign Het
Cdh19 A T 1: 110,821,026 (GRCm39) C571S probably damaging Het
Cep290 T A 10: 100,377,443 (GRCm39) L1491* probably null Het
Cherp G A 8: 73,215,840 (GRCm39) probably benign Het
Diaph3 T C 14: 87,274,893 (GRCm39) S188G probably null Het
Ech1 C T 7: 28,529,668 (GRCm39) R34C probably damaging Het
Erc2 T C 14: 27,499,134 (GRCm39) S337P possibly damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fah A G 7: 84,234,498 (GRCm39) V412A probably damaging Het
Gatc T A 5: 115,473,545 (GRCm39) E131D probably benign Het
Glrb A G 3: 80,769,337 (GRCm39) V130A possibly damaging Het
Gm4782 T A 6: 50,585,610 (GRCm39) probably null Het
Klhl1 C T 14: 96,619,206 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Myo15a G C 11: 60,368,505 (GRCm39) D422H probably damaging Het
Ncapd3 T A 9: 26,961,653 (GRCm39) H360Q probably damaging Het
Or1e22 T C 11: 73,376,766 (GRCm39) R295G probably benign Het
Rprd2 G A 3: 95,671,464 (GRCm39) P1313L probably damaging Het
Slc12a7 C A 13: 73,958,042 (GRCm39) D955E probably benign Het
Slc9a2 G A 1: 40,758,218 (GRCm39) probably null Het
Tex24 T A 8: 27,835,201 (GRCm39) V243D probably benign Het
Vmn2r17 A G 5: 109,577,463 (GRCm39) T505A probably benign Het
Vps37a T C 8: 40,997,977 (GRCm39) probably benign Het
Zmynd19 A G 2: 24,841,492 (GRCm39) Y20C probably damaging Het
Other mutations in Ppargc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ppargc1b APN 18 61,456,235 (GRCm39) missense probably damaging 1.00
IGL02160:Ppargc1b APN 18 61,443,506 (GRCm39) missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61,443,945 (GRCm39) missense probably damaging 1.00
IGL02176:Ppargc1b APN 18 61,443,946 (GRCm39) nonsense probably null
IGL02183:Ppargc1b APN 18 61,442,167 (GRCm39) critical splice acceptor site probably null
IGL02386:Ppargc1b APN 18 61,456,222 (GRCm39) missense probably damaging 1.00
IGL02620:Ppargc1b APN 18 61,431,810 (GRCm39) missense probably damaging 1.00
IGL02688:Ppargc1b APN 18 61,445,314 (GRCm39) missense possibly damaging 0.94
IGL02801:Ppargc1b APN 18 61,440,755 (GRCm39) missense possibly damaging 0.77
IGL02970:Ppargc1b APN 18 61,431,837 (GRCm39) missense probably damaging 1.00
R0033:Ppargc1b UTSW 18 61,440,765 (GRCm39) missense probably damaging 1.00
R0139:Ppargc1b UTSW 18 61,449,034 (GRCm39) splice site probably benign
R0194:Ppargc1b UTSW 18 61,441,016 (GRCm39) missense possibly damaging 0.94
R0412:Ppargc1b UTSW 18 61,448,932 (GRCm39) missense probably damaging 0.99
R0574:Ppargc1b UTSW 18 61,435,810 (GRCm39) missense probably benign 0.34
R0576:Ppargc1b UTSW 18 61,444,512 (GRCm39) missense probably damaging 0.98
R1546:Ppargc1b UTSW 18 61,443,677 (GRCm39) missense probably damaging 1.00
R1721:Ppargc1b UTSW 18 61,440,275 (GRCm39) splice site probably null
R1758:Ppargc1b UTSW 18 61,431,857 (GRCm39) splice site probably null
R1951:Ppargc1b UTSW 18 61,431,848 (GRCm39) missense possibly damaging 0.55
R2110:Ppargc1b UTSW 18 61,444,321 (GRCm39) missense probably benign 0.00
R2112:Ppargc1b UTSW 18 61,444,321 (GRCm39) missense probably benign 0.00
R2212:Ppargc1b UTSW 18 61,444,291 (GRCm39) nonsense probably null
R2432:Ppargc1b UTSW 18 61,440,870 (GRCm39) missense possibly damaging 0.93
R3848:Ppargc1b UTSW 18 61,444,113 (GRCm39) missense probably damaging 1.00
R3913:Ppargc1b UTSW 18 61,444,447 (GRCm39) missense probably damaging 0.99
R4328:Ppargc1b UTSW 18 61,515,540 (GRCm39) nonsense probably null
R4502:Ppargc1b UTSW 18 61,435,750 (GRCm39) missense probably benign 0.39
R4762:Ppargc1b UTSW 18 61,444,328 (GRCm39) missense possibly damaging 0.93
R5032:Ppargc1b UTSW 18 61,440,336 (GRCm39) missense probably damaging 1.00
R5111:Ppargc1b UTSW 18 61,443,558 (GRCm39) missense probably damaging 1.00
R5119:Ppargc1b UTSW 18 61,440,725 (GRCm39) missense probably benign 0.38
R5164:Ppargc1b UTSW 18 61,435,715 (GRCm39) missense probably damaging 1.00
R5266:Ppargc1b UTSW 18 61,448,876 (GRCm39) missense probably damaging 1.00
R5350:Ppargc1b UTSW 18 61,442,134 (GRCm39) missense possibly damaging 0.78
R5478:Ppargc1b UTSW 18 61,440,639 (GRCm39) missense probably benign
R5719:Ppargc1b UTSW 18 61,440,639 (GRCm39) missense probably benign
R5876:Ppargc1b UTSW 18 61,442,164 (GRCm39) missense probably damaging 0.99
R5877:Ppargc1b UTSW 18 61,442,164 (GRCm39) missense probably damaging 0.99
R5879:Ppargc1b UTSW 18 61,442,164 (GRCm39) missense probably damaging 0.99
R5967:Ppargc1b UTSW 18 61,431,837 (GRCm39) missense probably damaging 1.00
R6030:Ppargc1b UTSW 18 61,441,005 (GRCm39) nonsense probably null
R6030:Ppargc1b UTSW 18 61,441,005 (GRCm39) nonsense probably null
R6135:Ppargc1b UTSW 18 61,448,980 (GRCm39) missense probably damaging 0.99
R6533:Ppargc1b UTSW 18 61,440,845 (GRCm39) missense possibly damaging 0.93
R6791:Ppargc1b UTSW 18 61,440,747 (GRCm39) missense probably damaging 1.00
R6792:Ppargc1b UTSW 18 61,440,747 (GRCm39) missense probably damaging 1.00
R7033:Ppargc1b UTSW 18 61,440,785 (GRCm39) missense probably damaging 0.96
R7316:Ppargc1b UTSW 18 61,440,909 (GRCm39) missense probably damaging 0.97
R7560:Ppargc1b UTSW 18 61,445,281 (GRCm39) missense probably damaging 1.00
R8007:Ppargc1b UTSW 18 61,443,565 (GRCm39) missense possibly damaging 0.55
R8374:Ppargc1b UTSW 18 61,443,564 (GRCm39) missense probably damaging 0.99
R9072:Ppargc1b UTSW 18 61,443,730 (GRCm39) missense probably damaging 1.00
R9073:Ppargc1b UTSW 18 61,443,730 (GRCm39) missense probably damaging 1.00
R9178:Ppargc1b UTSW 18 61,443,993 (GRCm39) missense probably benign 0.06
R9339:Ppargc1b UTSW 18 61,456,267 (GRCm39) missense probably damaging 1.00
R9357:Ppargc1b UTSW 18 61,448,939 (GRCm39) missense probably damaging 0.99
R9406:Ppargc1b UTSW 18 61,444,051 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTGGTGGACCACAGAATACCTC -3'
(R):5'- CGGGATGTTAACAAGCCTACAAG -3'

Sequencing Primer
(F):5'- AATACCTCTGGAAGTGGGCTG -3'
(R):5'- CCTACAAGGCAAAAGCGGG -3'
Posted On 2015-02-19