Incidental Mutation 'R3624:Trim54'
ID269311
Institutional Source Beutler Lab
Gene Symbol Trim54
Ensembl Gene ENSMUSG00000062077
Gene Nametripartite motif-containing 54
SynonymsRnf30, 4930566I02Rik, MuRF3, 4930486E09Rik
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31116712-31137630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31136976 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 319 (V319M)
Ref Sequence ENSEMBL: ENSMUSP00000144629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013771] [ENSMUST00000043475] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201184] [ENSMUST00000201353] [ENSMUST00000202241] [ENSMUST00000202769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013771
AA Change: V319M

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013771
Gene: ENSMUSG00000062077
AA Change: V319M

DomainStartEndE-ValueType
RING 26 81 8.61e-9 SMART
BBOX 121 163 1.23e-4 SMART
Blast:BBC 170 295 1e-27 BLAST
low complexity region 331 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043475
SMART Domains Protein: ENSMUSP00000035321
Gene: ENSMUSG00000038676

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 62 N/A INTRINSIC
CRF 81 119 4.02e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201171
Predicted Effect probably benign
Transcript: ENSMUST00000201184
SMART Domains Protein: ENSMUSP00000144390
Gene: ENSMUSG00000038676

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 62 N/A INTRINSIC
CRF 81 119 4.02e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201750
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202769
AA Change: V319M

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144629
Gene: ENSMUSG00000062077
AA Change: V319M

DomainStartEndE-ValueType
RING 26 81 8.61e-9 SMART
BBOX 121 163 1.23e-4 SMART
Blast:BBC 170 295 1e-27 BLAST
low complexity region 331 348 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202836
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is highly similar to the ring finger proteins RNF28/MURF1 and RNF29/MURF2. In vitro studies demonstrated that this protein, RNF28, and RNF29 form heterodimers, which may be important for the regulation of titin kinase and microtubule-dependent signal pathways in striated muscles. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cardiac function but are prone to cardiac rupture after acute myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Trim54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Trim54 APN 5 31136958 missense probably benign 0.00
IGL02393:Trim54 APN 5 31131980 splice site probably benign
IGL02545:Trim54 APN 5 31132165 splice site probably benign
IGL02664:Trim54 APN 5 31136047 missense probably damaging 1.00
IGL03012:Trim54 APN 5 31137145 missense probably benign
IGL03160:Trim54 APN 5 31132080 missense probably damaging 0.96
R0238:Trim54 UTSW 5 31134119 missense probably benign 0.18
R0238:Trim54 UTSW 5 31134119 missense probably benign 0.18
R0617:Trim54 UTSW 5 31136182 unclassified probably null
R3753:Trim54 UTSW 5 31134144 missense probably damaging 0.99
R6815:Trim54 UTSW 5 31134080 missense probably damaging 1.00
R7350:Trim54 UTSW 5 31137161 missense probably benign
R7575:Trim54 UTSW 5 31134087 missense possibly damaging 0.55
X0028:Trim54 UTSW 5 31117078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGATCAACAAGTGAGTGGAC -3'
(R):5'- CCATCCAAAGCCATGTCGTC -3'

Sequencing Primer
(F):5'- CAAGTGAGTGGACTGCGC -3'
(R):5'- AAAGCCATGTCGTCATCCTC -3'
Posted On2015-02-19