Incidental Mutation 'R3624:Rspry1'
ID269328
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94649777 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 309 (D309G)
Ref Sequence ENSEMBL: ENSMUSP00000148724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: D433G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: D433G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211941
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: D433G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212729
AA Change: D309G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9390 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGCCGAGAAGCAAATCAGC -3'
(R):5'- GAGGTCAGATCAAATGGAGCTCTAG -3'

Sequencing Primer
(F):5'- GGCTTGTCATAGTTTAAATGGAAGC -3'
(R):5'- AGATCAAATGGAGCTCTAGTTAATTG -3'
Posted On2015-02-19