Incidental Mutation 'R3624:Anks1'
ID269351
Institutional Source Beutler Lab
Gene Symbol Anks1
Ensembl Gene ENSMUSG00000024219
Gene Nameankyrin repeat and SAM domain containing 1
SynonymsOdin
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location27909340-28062600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27986288 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 274 (F274L)
Ref Sequence ENSEMBL: ENSMUSP00000025058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000088027] [ENSMUST00000114842]
Predicted Effect probably damaging
Transcript: ENSMUST00000025058
AA Change: F274L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219
AA Change: F274L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088027
AA Change: F253L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219
AA Change: F253L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114842
AA Change: F274L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219
AA Change: F274L

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156965
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Anks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Anks1 APN 17 28058416 missense possibly damaging 0.94
IGL00816:Anks1 APN 17 28059393 critical splice donor site probably null
IGL00940:Anks1 APN 17 28057354 missense probably damaging 1.00
IGL01306:Anks1 APN 17 27986253 missense probably damaging 1.00
IGL01485:Anks1 APN 17 28051584 missense probably damaging 1.00
IGL02059:Anks1 APN 17 28008046 missense possibly damaging 0.64
IGL02220:Anks1 APN 17 28054707 missense probably damaging 0.98
IGL02955:Anks1 APN 17 28054317 missense probably damaging 1.00
IGL03071:Anks1 APN 17 28008199 missense probably benign 0.37
ANU23:Anks1 UTSW 17 27986253 missense probably damaging 1.00
R0389:Anks1 UTSW 17 27995952 missense possibly damaging 0.68
R1221:Anks1 UTSW 17 28050642 missense possibly damaging 0.62
R1523:Anks1 UTSW 17 28051655 splice site probably null
R1639:Anks1 UTSW 17 28058306 missense probably damaging 1.00
R1816:Anks1 UTSW 17 27986573 missense probably damaging 1.00
R1981:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R1982:Anks1 UTSW 17 27985121 missense probably damaging 1.00
R2041:Anks1 UTSW 17 28008414 missense probably damaging 1.00
R2099:Anks1 UTSW 17 27978491 critical splice donor site probably null
R2897:Anks1 UTSW 17 27985363 critical splice donor site probably null
R2965:Anks1 UTSW 17 28053905 missense probably benign
R4671:Anks1 UTSW 17 28051578 missense probably benign 0.45
R4786:Anks1 UTSW 17 28052730 missense possibly damaging 0.93
R4871:Anks1 UTSW 17 27991377 missense probably benign 0.00
R4936:Anks1 UTSW 17 27988805 missense probably damaging 1.00
R5175:Anks1 UTSW 17 28042588 missense probably damaging 1.00
R5908:Anks1 UTSW 17 27996019 missense probably damaging 1.00
R5975:Anks1 UTSW 17 27991447 intron probably null
R6226:Anks1 UTSW 17 28057330 missense probably benign 0.01
R6306:Anks1 UTSW 17 28050639 missense probably damaging 1.00
R6332:Anks1 UTSW 17 28052735 missense probably benign
R6891:Anks1 UTSW 17 28057424 missense probably damaging 1.00
R6995:Anks1 UTSW 17 28054299 missense probably damaging 1.00
R7465:Anks1 UTSW 17 28054323 missense possibly damaging 0.48
R7502:Anks1 UTSW 17 28008140 missense possibly damaging 0.48
R7749:Anks1 UTSW 17 28038141 missense probably damaging 0.96
R8005:Anks1 UTSW 17 28059367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAGCTTTAGAACCCACAC -3'
(R):5'- AACGAGCATTCTTCACTCGG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- TCGGCCATCAATAGTCCCG -3'
Posted On2015-02-19