Incidental Mutation 'R3624:Klhl14'
ID269357
Institutional Source Beutler Lab
Gene Symbol Klhl14
Ensembl Gene ENSMUSG00000042514
Gene Namekelch-like 14
Synonymsprintor, 6330403N15Rik
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location21550377-21654718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21557896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 499 (V499D)
Ref Sequence ENSEMBL: ENSMUSP00000113755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]
Predicted Effect probably damaging
Transcript: ENSMUST00000049105
AA Change: V499D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: V499D

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122333
AA Change: V499D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: V499D

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Klhl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Klhl14 APN 18 21651864 missense probably benign 0.00
IGL01474:Klhl14 APN 18 21557854 missense probably damaging 0.99
IGL02005:Klhl14 APN 18 21624611 nonsense probably null
IGL02108:Klhl14 APN 18 21557920 missense probably damaging 0.98
IGL02371:Klhl14 APN 18 21652181 missense probably damaging 1.00
IGL03354:Klhl14 APN 18 21651728 missense probably damaging 1.00
P0027:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
PIT4810001:Klhl14 UTSW 18 21557823 nonsense probably null
R0288:Klhl14 UTSW 18 21565563 missense probably damaging 1.00
R1419:Klhl14 UTSW 18 21652193 missense probably damaging 0.99
R1606:Klhl14 UTSW 18 21565532 missense possibly damaging 0.94
R1771:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R1928:Klhl14 UTSW 18 21651786 missense probably damaging 1.00
R1966:Klhl14 UTSW 18 21554673 missense probably damaging 1.00
R4541:Klhl14 UTSW 18 21554639 nonsense probably null
R4664:Klhl14 UTSW 18 21554708 missense probably benign 0.06
R4856:Klhl14 UTSW 18 21557972 intron probably null
R4886:Klhl14 UTSW 18 21557972 intron probably null
R4893:Klhl14 UTSW 18 21557935 missense probably damaging 1.00
R5393:Klhl14 UTSW 18 21651994 missense probably benign 0.30
R5757:Klhl14 UTSW 18 21554734 missense probably damaging 1.00
R5951:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R5958:Klhl14 UTSW 18 21565535 missense probably damaging 0.99
R7231:Klhl14 UTSW 18 21652136 missense probably damaging 0.99
R7519:Klhl14 UTSW 18 21651843 missense probably benign 0.36
R7527:Klhl14 UTSW 18 21651540 missense probably damaging 0.99
R7573:Klhl14 UTSW 18 21652154 missense probably benign 0.00
R7664:Klhl14 UTSW 18 21554649 missense probably damaging 1.00
R7737:Klhl14 UTSW 18 21558134 nonsense probably null
T0722:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
X0026:Klhl14 UTSW 18 21651941 missense possibly damaging 0.94
Z1177:Klhl14 UTSW 18 21652104 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTAATGCAAATGCTACTTGGAC -3'
(R):5'- GGAGTGCTACAACCTAGACAC -3'

Sequencing Primer
(F):5'- GCAAATGCTACTTGGACATATAAAAC -3'
(R):5'- CAAACGAGTGGCGCTATGTGTC -3'
Posted On2015-02-19