Incidental Mutation 'R3624:Dock8'
ID269358
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25079877 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 216 (Q216R)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: Q216R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: Q216R

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Emilin3 T C 2: 160,908,257 D477G possibly damaging Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTTGAGACATCCCTGAG -3'
(R):5'- AGCATCCAGATATTCACGCTGTTC -3'

Sequencing Primer
(F):5'- GCCTTGAGACATCCCTGAGTCTAG -3'
(R):5'- CTGTTCTACAGTGTCAGAGAGCAG -3'
Posted On2015-02-19