Incidental Mutation 'R3625:Pogk'
ID269363
Institutional Source Beutler Lab
Gene Symbol Pogk
Ensembl Gene ENSMUSG00000040596
Gene Namepogo transposable element with KRAB domain
SynonymsBASS2, 9130401E23Rik
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location166384622-166409863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 166403512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 82 (T82I)
Ref Sequence ENSEMBL: ENSMUSP00000120963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127596] [ENSMUST00000128861] [ENSMUST00000131487] [ENSMUST00000135673] [ENSMUST00000148243] [ENSMUST00000169324]
Predicted Effect probably damaging
Transcript: ENSMUST00000127596
AA Change: T82I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120963
Gene: ENSMUSG00000040596
AA Change: T82I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 105 6.31e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128861
AA Change: T89I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118270
Gene: ENSMUSG00000040596
AA Change: T89I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131487
AA Change: T89I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116477
Gene: ENSMUSG00000040596
AA Change: T89I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135673
AA Change: T101I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120352
Gene: ENSMUSG00000040596
AA Change: T101I

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
KRAB 47 107 1.53e-19 SMART
Pfam:BrkDBD 195 247 2.1e-29 PFAM
CENPB 256 323 3.93e-21 SMART
Pfam:DDE_1 355 567 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148243
SMART Domains Protein: ENSMUSP00000118877
Gene: ENSMUSG00000040596

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169324
AA Change: T101I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127395
Gene: ENSMUSG00000040596
AA Change: T101I

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
KRAB 66 126 1.53e-19 SMART
Pfam:BrkDBD 214 266 8.7e-29 PFAM
CENPB 275 342 3.93e-21 SMART
Pfam:DDE_1 414 586 1.5e-48 PFAM
Meta Mutation Damage Score 0.5372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of the protein encoded by this gene is not known. However, this gene product contains a KRAB domain (which is involved in protein-protein interactions) at the N-terminus, and a transposase domain at the C-terminus, suggesting that it may belong to the family of DNA-mediated transposons in human. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Pogk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pogk APN 1 166408478 missense probably damaging 1.00
R0395:Pogk UTSW 1 166403602 missense probably damaging 1.00
R1387:Pogk UTSW 1 166400138 missense possibly damaging 0.85
R1556:Pogk UTSW 1 166398833 missense possibly damaging 0.59
R1752:Pogk UTSW 1 166408428 missense probably damaging 0.96
R3901:Pogk UTSW 1 166403624 missense probably damaging 1.00
R3902:Pogk UTSW 1 166403624 missense probably damaging 1.00
R4288:Pogk UTSW 1 166403506 missense probably damaging 1.00
R4612:Pogk UTSW 1 166398765 nonsense probably null
R5079:Pogk UTSW 1 166399164 missense probably damaging 1.00
R5788:Pogk UTSW 1 166409011 intron probably benign
R6488:Pogk UTSW 1 166399422 missense possibly damaging 0.79
R6708:Pogk UTSW 1 166403509 missense probably damaging 1.00
R7603:Pogk UTSW 1 166401911 missense probably benign 0.03
X0010:Pogk UTSW 1 166398797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGAAATTAGGTTGACATAGGC -3'
(R):5'- TTGTCTCCAAGAGCAGTGAG -3'

Sequencing Primer
(F):5'- AAATTAGGTTGACATAGGCTTGGGC -3'
(R):5'- CCCTGAAGTGACCTGTGAGAATG -3'
Posted On2015-02-19