Incidental Mutation 'R3625:Kdm1a'
ID269369
Institutional Source Beutler Lab
Gene Symbol Kdm1a
Ensembl Gene ENSMUSG00000036940
Gene Namelysine (K)-specific demethylase 1A
SynonymsAof2, 1810043O07Rik, Kdm1, LSD1
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136550540-136602723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136561108 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 388 (E388G)
Ref Sequence ENSEMBL: ENSMUSP00000111977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105847] [ENSMUST00000116273]
Predicted Effect probably benign
Transcript: ENSMUST00000046846
SMART Domains Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
low complexity region 47 80 N/A INTRINSIC
Pfam:SWIRM 85 173 1.1e-20 PFAM
Pfam:AlaDh_PNT_C 181 297 8.4e-8 PFAM
Pfam:FAD_binding_2 189 236 1.6e-6 PFAM
Pfam:Pyr_redox 189 237 6.5e-7 PFAM
Pfam:DAO 189 457 1.5e-9 PFAM
Pfam:NAD_binding_8 192 256 9e-16 PFAM
Pfam:Amino_oxidase 197 657 7e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105847
AA Change: E408G

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940
AA Change: E408G

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
Pfam:SWIRM 197 285 8.8e-21 PFAM
Pfam:FAD_binding_2 301 348 6e-6 PFAM
Pfam:Pyr_redox 301 349 3e-6 PFAM
Pfam:DAO 301 557 9.9e-9 PFAM
Pfam:NAD_binding_8 304 368 4e-15 PFAM
Pfam:Amino_oxidase 309 847 2e-133 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116273
AA Change: E388G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940
AA Change: E388G

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
Pfam:SWIRM 175 265 2.7e-21 PFAM
Pfam:Pyr_redox 281 327 5.5e-7 PFAM
Pfam:FAD_binding_2 281 328 5.3e-6 PFAM
Pfam:DAO 281 403 3.7e-8 PFAM
Pfam:NAD_binding_8 284 348 5.7e-16 PFAM
Pfam:Amino_oxidase 289 827 9.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147886
Predicted Effect unknown
Transcript: ENSMUST00000155354
AA Change: E29G
SMART Domains Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940
AA Change: E29G

DomainStartEndE-ValueType
Pfam:Amino_oxidase 3 250 2.9e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170979
AA Change: E203G
SMART Domains Protein: ENSMUSP00000131385
Gene: ENSMUSG00000036940
AA Change: E203G

DomainStartEndE-ValueType
Pfam:SWIRM 1 77 2.5e-18 PFAM
Pfam:Pyr_redox_2 70 142 1.1e-7 PFAM
Pfam:AlaDh_PNT_C 85 195 7.8e-8 PFAM
Pfam:FAD_binding_2 93 140 1.7e-6 PFAM
Pfam:Pyr_redox 93 142 8.2e-7 PFAM
Pfam:DAO 93 319 2.8e-9 PFAM
Pfam:NAD_binding_8 96 160 9.8e-16 PFAM
Pfam:Amino_oxidase 101 313 5.1e-32 PFAM
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Kdm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Kdm1a APN 4 136554247 missense probably damaging 1.00
IGL01106:Kdm1a APN 4 136572328 splice site probably benign
IGL01356:Kdm1a APN 4 136553891 missense probably damaging 1.00
IGL01886:Kdm1a APN 4 136561016 critical splice donor site probably null
IGL02605:Kdm1a APN 4 136551037 unclassified probably benign
IGL02885:Kdm1a APN 4 136552535 missense probably benign 0.00
seven_falls UTSW 4 136568600 nonsense probably null
R0095:Kdm1a UTSW 4 136550894 missense probably benign 0.09
R0532:Kdm1a UTSW 4 136561066 missense probably damaging 1.00
R0553:Kdm1a UTSW 4 136555298 missense probably damaging 1.00
R4085:Kdm1a UTSW 4 136551962 nonsense probably null
R4285:Kdm1a UTSW 4 136582036 splice site probably null
R5118:Kdm1a UTSW 4 136557358 unclassified probably benign
R5493:Kdm1a UTSW 4 136557421 frame shift probably null
R5800:Kdm1a UTSW 4 136573070 splice site probably null
R5945:Kdm1a UTSW 4 136568701 intron probably null
R6256:Kdm1a UTSW 4 136568600 nonsense probably null
R6508:Kdm1a UTSW 4 136554310 missense probably damaging 1.00
R7243:Kdm1a UTSW 4 136551954 missense probably damaging 1.00
R7270:Kdm1a UTSW 4 136552527 missense probably damaging 0.97
X0066:Kdm1a UTSW 4 136559225 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAAGTGGCCTTGGGGATTC -3'
(R):5'- CAGGCCTGAAACATTTCATATCTC -3'

Sequencing Primer
(F):5'- CTGTTACTATACAGACAGCCCTTAGG -3'
(R):5'- AGTCAAATCATTGTCCTCAAAGG -3'
Posted On2015-02-19