Incidental Mutation 'R3625:Prkcsh'
ID269379
Institutional Source Beutler Lab
Gene Symbol Prkcsh
Ensembl Gene ENSMUSG00000003402
Gene Nameprotein kinase C substrate 80K-H
Synonyms80K-H
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22002806-22014222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22011252 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 283 (E283G)
Ref Sequence ENSEMBL: ENSMUSP00000149936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000003493] [ENSMUST00000003501] [ENSMUST00000115331] [ENSMUST00000215795] [ENSMUST00000216344]
Predicted Effect probably null
Transcript: ENSMUST00000003493
AA Change: E283G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402
AA Change: E283G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000003493
AA Change: E283G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402
AA Change: E283G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003501
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115331
AA Change: E283G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402
AA Change: E283G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214565
Predicted Effect probably benign
Transcript: ENSMUST00000215795
Predicted Effect probably null
Transcript: ENSMUST00000216344
AA Change: E283G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Prkcsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Prkcsh APN 9 22006565 missense possibly damaging 0.95
R0306:Prkcsh UTSW 9 22006526 splice site probably benign
R0376:Prkcsh UTSW 9 22010251 splice site probably benign
R1690:Prkcsh UTSW 9 22010575 missense probably damaging 1.00
R1834:Prkcsh UTSW 9 22008338 missense probably damaging 0.98
R1856:Prkcsh UTSW 9 22004575 missense possibly damaging 0.55
R1980:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1981:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1982:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R2184:Prkcsh UTSW 9 22004732 missense probably damaging 1.00
R4798:Prkcsh UTSW 9 22011738 missense probably damaging 1.00
R5059:Prkcsh UTSW 9 22012750 missense probably damaging 1.00
R5580:Prkcsh UTSW 9 22011255 critical splice donor site probably null
R7055:Prkcsh UTSW 9 22013161 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTCCTGGTCAGAGTACC -3'
(R):5'- AACAGGTATGTCAGTGGGCG -3'

Sequencing Primer
(F):5'- TCAGAGTACCTGGCCCCTCTG -3'
(R):5'- CTAGCAGACCCAGGAGTGTG -3'
Posted On2015-02-19