Incidental Mutation 'R3625:Grxcr2'
ID269398
Institutional Source Beutler Lab
Gene Symbol Grxcr2
Ensembl Gene ENSMUSG00000073574
Gene Nameglutaredoxin, cysteine rich 2
SynonymsLOC332309
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3625 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location41986201-41999049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41998818 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 62 (D62V)
Ref Sequence ENSEMBL: ENSMUSP00000095198 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000097591
AA Change: D62V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a glutaredoxin domain, which functions in protein S-glutathionylation. A mutation in this gene was found in a family with autoosomal recessive nonsyndromic sensorineural deafness-101. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Nkx6-2 A G 7: 139,582,190 F117S possibly damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Grxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Grxcr2 APN 18 41998982 missense probably damaging 1.00
IGL02823:Grxcr2 APN 18 41991981 missense probably damaging 1.00
R4452:Grxcr2 UTSW 18 41986544 missense probably damaging 1.00
R5317:Grxcr2 UTSW 18 41998851 missense probably damaging 0.99
R6054:Grxcr2 UTSW 18 41986678 missense probably benign 0.01
R6483:Grxcr2 UTSW 18 41991890 missense probably benign
R6493:Grxcr2 UTSW 18 41998701 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACCGATCTGAAGCACTTTGG -3'
(R):5'- CGGGAACTTTCTGCTGATGG -3'

Sequencing Primer
(F):5'- TTTCAAGGAGCCTACCTTAGAAG -3'
(R):5'- AACTTTCTGCTGATGGAGGACTC -3'
Posted On2015-02-19