Incidental Mutation 'R3683:Ptprq'
ID269439
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 040681-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R3683 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107708628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 347 (T347K)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: T347K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: T347K

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik T C X: 81,420,235 D622G possibly damaging Het
Acad11 T C 9: 104,115,344 I495T probably damaging Het
Acat1 C T 9: 53,587,465 A307T probably damaging Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Bmp2 T A 2: 133,554,472 V16D probably benign Het
Cables2 G A 2: 180,264,470 R121* probably null Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Csrnp2 A T 15: 100,481,998 S471T probably benign Het
Dnah7a C A 1: 53,444,516 M3367I probably benign Het
Elp4 A T 2: 105,702,761 M413K possibly damaging Het
Fat1 A G 8: 45,017,938 D1593G probably benign Het
Fbxw24 G A 9: 109,608,042 P259L possibly damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gm14124 A G 2: 150,268,056 K222R probably benign Het
Klra9 T C 6: 130,191,297 N2S probably benign Het
Lama1 A G 17: 67,768,333 D1015G probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nrxn1 T C 17: 90,623,452 D779G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Olfr709-ps1 G A 7: 106,927,094 R122* probably null Het
Osmr A C 15: 6,837,053 V380G possibly damaging Het
Phf21b A G 15: 84,798,690 I222T probably damaging Het
Sema6d G T 2: 124,654,226 L63F possibly damaging Het
Serpinb9b C T 13: 33,029,598 A46V probably damaging Het
Sf3b3 A G 8: 110,813,621 probably null Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Stat4 C T 1: 52,013,822 T54I possibly damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tbc1d20 C T 2: 152,311,817 T354I probably benign Het
Tbc1d31 T C 15: 57,951,814 probably null Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Utrn A G 10: 12,666,835 M1802T probably benign Het
Vmn1r8 A C 6: 57,036,275 T104P probably damaging Het
Vmn2r13 C A 5: 109,156,855 R570I probably damaging Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Zmpste24 A G 4: 121,061,091 F445L probably damaging Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCGCTCAACATCCTTATCATTTGTG -3'
(R):5'- TCCACCTGTATGTCAACCCG -3'

Sequencing Primer
(F):5'- CAGGGTCTTCTCAGGAAAT -3'
(R):5'- GCAAATAGCTGCATTAGGACAATATG -3'
Posted On2015-02-19