Incidental Mutation 'R3683:Osmr'
ID269444
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission 040681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3683 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6837053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 380 (V380G)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022746
AA Change: V380G

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: V380G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175862
Predicted Effect possibly damaging
Transcript: ENSMUST00000176826
AA Change: V380G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: V380G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik T C X: 81,420,235 D622G possibly damaging Het
Acad11 T C 9: 104,115,344 I495T probably damaging Het
Acat1 C T 9: 53,587,465 A307T probably damaging Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Bmp2 T A 2: 133,554,472 V16D probably benign Het
Cables2 G A 2: 180,264,470 R121* probably null Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Csrnp2 A T 15: 100,481,998 S471T probably benign Het
Dnah7a C A 1: 53,444,516 M3367I probably benign Het
Elp4 A T 2: 105,702,761 M413K possibly damaging Het
Fat1 A G 8: 45,017,938 D1593G probably benign Het
Fbxw24 G A 9: 109,608,042 P259L possibly damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gm14124 A G 2: 150,268,056 K222R probably benign Het
Klra9 T C 6: 130,191,297 N2S probably benign Het
Lama1 A G 17: 67,768,333 D1015G probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nrxn1 T C 17: 90,623,452 D779G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Olfr709-ps1 G A 7: 106,927,094 R122* probably null Het
Phf21b A G 15: 84,798,690 I222T probably damaging Het
Ptprq G T 10: 107,708,628 T347K probably benign Het
Sema6d G T 2: 124,654,226 L63F possibly damaging Het
Serpinb9b C T 13: 33,029,598 A46V probably damaging Het
Sf3b3 A G 8: 110,813,621 probably null Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Stat4 C T 1: 52,013,822 T54I possibly damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tbc1d20 C T 2: 152,311,817 T354I probably benign Het
Tbc1d31 T C 15: 57,951,814 probably null Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Utrn A G 10: 12,666,835 M1802T probably benign Het
Vmn1r8 A C 6: 57,036,275 T104P probably damaging Het
Vmn2r13 C A 5: 109,156,855 R570I probably damaging Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Zmpste24 A G 4: 121,061,091 F445L probably damaging Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6349:Osmr UTSW 15 6821063 missense probably benign 0.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGTCATCCCATATTCTTTGGC -3'
(R):5'- TAGTGGGTCCTGCAATTGATC -3'

Sequencing Primer
(F):5'- TGGCTTACACCATGATATCAATACC -3'
(R):5'- CCTGCAATTGATCTAAATATTTGGC -3'
Posted On2015-02-19