Incidental Mutation 'R3683:Tbc1d31'
ID269445
Institutional Source Beutler Lab
Gene Symbol Tbc1d31
Ensembl Gene ENSMUSG00000022364
Gene NameTBC1 domain family, member 31
SynonymsLOC210544, Wdr67, D330013L20Rik
MMRRC Submission 040681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3683 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location57912199-57970067 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 57951814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022992]
Predicted Effect probably null
Transcript: ENSMUST00000022992
SMART Domains Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364

DomainStartEndE-ValueType
WD40 39 70 3.3e1 SMART
WD40 72 112 7.64e1 SMART
WD40 115 153 1.42e-4 SMART
WD40 156 196 1.03e1 SMART
WD40 199 242 6.6e1 SMART
Blast:WD40 245 292 8e-23 BLAST
WD40 295 334 2.48e0 SMART
Pfam:RabGAP-TBC 427 619 9.5e-11 PFAM
coiled coil region 699 844 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162157
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik T C X: 81,420,235 D622G possibly damaging Het
Acad11 T C 9: 104,115,344 I495T probably damaging Het
Acat1 C T 9: 53,587,465 A307T probably damaging Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Bmp2 T A 2: 133,554,472 V16D probably benign Het
Cables2 G A 2: 180,264,470 R121* probably null Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Csrnp2 A T 15: 100,481,998 S471T probably benign Het
Dnah7a C A 1: 53,444,516 M3367I probably benign Het
Elp4 A T 2: 105,702,761 M413K possibly damaging Het
Fat1 A G 8: 45,017,938 D1593G probably benign Het
Fbxw24 G A 9: 109,608,042 P259L possibly damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gm14124 A G 2: 150,268,056 K222R probably benign Het
Klra9 T C 6: 130,191,297 N2S probably benign Het
Lama1 A G 17: 67,768,333 D1015G probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nrxn1 T C 17: 90,623,452 D779G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Olfr709-ps1 G A 7: 106,927,094 R122* probably null Het
Osmr A C 15: 6,837,053 V380G possibly damaging Het
Phf21b A G 15: 84,798,690 I222T probably damaging Het
Ptprq G T 10: 107,708,628 T347K probably benign Het
Sema6d G T 2: 124,654,226 L63F possibly damaging Het
Serpinb9b C T 13: 33,029,598 A46V probably damaging Het
Sf3b3 A G 8: 110,813,621 probably null Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Stat4 C T 1: 52,013,822 T54I possibly damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tbc1d20 C T 2: 152,311,817 T354I probably benign Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Utrn A G 10: 12,666,835 M1802T probably benign Het
Vmn1r8 A C 6: 57,036,275 T104P probably damaging Het
Vmn2r13 C A 5: 109,156,855 R570I probably damaging Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Zmpste24 A G 4: 121,061,091 F445L probably damaging Het
Other mutations in Tbc1d31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Tbc1d31 APN 15 57940768 missense probably benign 0.03
IGL01955:Tbc1d31 APN 15 57942370 missense probably benign 0.24
IGL02024:Tbc1d31 APN 15 57919942 missense probably benign 0.10
IGL02501:Tbc1d31 APN 15 57937948 missense probably benign 0.11
IGL03133:Tbc1d31 APN 15 57942459 splice site probably benign
IGL03159:Tbc1d31 APN 15 57920048 critical splice donor site probably null
new_age UTSW 15 57951706 missense probably damaging 1.00
PIT4354001:Tbc1d31 UTSW 15 57967933 missense probably benign 0.09
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0375:Tbc1d31 UTSW 15 57955350 missense probably benign
R0478:Tbc1d31 UTSW 15 57932536 missense probably damaging 1.00
R0576:Tbc1d31 UTSW 15 57969724 missense possibly damaging 0.79
R1328:Tbc1d31 UTSW 15 57942463 splice site probably benign
R1454:Tbc1d31 UTSW 15 57951638 nonsense probably null
R1784:Tbc1d31 UTSW 15 57963920 missense possibly damaging 0.86
R1874:Tbc1d31 UTSW 15 57916110 missense probably benign 0.41
R1920:Tbc1d31 UTSW 15 57912364 missense probably damaging 1.00
R2111:Tbc1d31 UTSW 15 57932644 missense probably benign 0.05
R2174:Tbc1d31 UTSW 15 57951741 missense possibly damaging 0.95
R2205:Tbc1d31 UTSW 15 57953520 missense probably benign 0.11
R3825:Tbc1d31 UTSW 15 57916078 missense probably benign 0.43
R4407:Tbc1d31 UTSW 15 57920042 missense possibly damaging 0.93
R4627:Tbc1d31 UTSW 15 57967912 missense probably benign
R4792:Tbc1d31 UTSW 15 57940728 missense probably benign 0.03
R4804:Tbc1d31 UTSW 15 57951106 nonsense probably null
R4909:Tbc1d31 UTSW 15 57962265 critical splice donor site probably null
R5077:Tbc1d31 UTSW 15 57955401 missense probably benign 0.00
R5230:Tbc1d31 UTSW 15 57960919 missense probably damaging 0.99
R5436:Tbc1d31 UTSW 15 57952871 missense probably benign 0.04
R5652:Tbc1d31 UTSW 15 57951666 missense probably damaging 1.00
R5920:Tbc1d31 UTSW 15 57942558 missense probably benign 0.10
R6102:Tbc1d31 UTSW 15 57936093 missense probably damaging 1.00
R6176:Tbc1d31 UTSW 15 57952796 missense probably damaging 0.99
R6513:Tbc1d31 UTSW 15 57955382 missense probably damaging 1.00
R6778:Tbc1d31 UTSW 15 57938029 missense probably damaging 1.00
R6795:Tbc1d31 UTSW 15 57951706 missense probably damaging 1.00
R7187:Tbc1d31 UTSW 15 57938063 missense possibly damaging 0.95
R7308:Tbc1d31 UTSW 15 57952816 missense probably damaging 1.00
R7359:Tbc1d31 UTSW 15 57916108 missense probably benign 0.00
R7453:Tbc1d31 UTSW 15 57950995 missense probably damaging 1.00
R7552:Tbc1d31 UTSW 15 57940740 missense probably benign
R7606:Tbc1d31 UTSW 15 57951670 missense probably damaging 1.00
R7739:Tbc1d31 UTSW 15 57936098 nonsense probably null
R7782:Tbc1d31 UTSW 15 57958368 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTTTAGGTGTATGCCTGGCC -3'
(R):5'- TTATAACAACCTGCTTGCCAAG -3'

Sequencing Primer
(F):5'- TGGCCTCTCCTGGAAACACTG -3'
(R):5'- TGCTTGCCAAGAATCTACGC -3'
Posted On2015-02-19