Incidental Mutation 'R3683:Tmem181a'
ID269449
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission 040681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3683 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6295786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 185 (L185H)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383]
Predicted Effect probably damaging
Transcript: ENSMUST00000088940
AA Change: L185H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: L185H

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231593
Predicted Effect probably damaging
Transcript: ENSMUST00000232383
AA Change: L226H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.2866 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930595M18Rik T C X: 81,420,235 D622G possibly damaging Het
Acad11 T C 9: 104,115,344 I495T probably damaging Het
Acat1 C T 9: 53,587,465 A307T probably damaging Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Bmp2 T A 2: 133,554,472 V16D probably benign Het
Cables2 G A 2: 180,264,470 R121* probably null Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Csrnp2 A T 15: 100,481,998 S471T probably benign Het
Dnah7a C A 1: 53,444,516 M3367I probably benign Het
Elp4 A T 2: 105,702,761 M413K possibly damaging Het
Fat1 A G 8: 45,017,938 D1593G probably benign Het
Fbxw24 G A 9: 109,608,042 P259L possibly damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gm14124 A G 2: 150,268,056 K222R probably benign Het
Klra9 T C 6: 130,191,297 N2S probably benign Het
Lama1 A G 17: 67,768,333 D1015G probably benign Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nrxn1 T C 17: 90,623,452 D779G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Olfr709-ps1 G A 7: 106,927,094 R122* probably null Het
Osmr A C 15: 6,837,053 V380G possibly damaging Het
Phf21b A G 15: 84,798,690 I222T probably damaging Het
Ptprq G T 10: 107,708,628 T347K probably benign Het
Sema6d G T 2: 124,654,226 L63F possibly damaging Het
Serpinb9b C T 13: 33,029,598 A46V probably damaging Het
Sf3b3 A G 8: 110,813,621 probably null Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Stat4 C T 1: 52,013,822 T54I possibly damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tbc1d20 C T 2: 152,311,817 T354I probably benign Het
Tbc1d31 T C 15: 57,951,814 probably null Het
Tmcc1 C CAT 6: 116,042,870 probably null Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Utrn A G 10: 12,666,835 M1802T probably benign Het
Vmn1r8 A C 6: 57,036,275 T104P probably damaging Het
Vmn2r13 C A 5: 109,156,855 R570I probably damaging Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Zmpste24 A G 4: 121,061,091 F445L probably damaging Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
a_team UTSW 17 6295786 missense probably damaging 0.99
abraham UTSW 17 6290599 missense probably benign 0.03
PIT4651001:Tmem181a UTSW 17 6300895 missense probably benign
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4429:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
R7131:Tmem181a UTSW 17 6297972 missense probably damaging 0.98
R7231:Tmem181a UTSW 17 6297920 missense possibly damaging 0.81
R7374:Tmem181a UTSW 17 6304258 missense possibly damaging 0.85
R7437:Tmem181a UTSW 17 6303265 missense possibly damaging 0.70
R7592:Tmem181a UTSW 17 6289020 missense probably benign 0.00
R8175:Tmem181a UTSW 17 6295800 missense probably benign 0.00
R8327:Tmem181a UTSW 17 6301405 missense probably damaging 1.00
R8385:Tmem181a UTSW 17 6288999 missense probably benign 0.10
RF010:Tmem181a UTSW 17 6280703 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCATGGGAGAACTGTTTCTG -3'
(R):5'- GGTCAGCAATGACTCTCACAC -3'

Sequencing Primer
(F):5'- CCATGGGAGAACTGTTTCTGGTAGTC -3'
(R):5'- TGACTCTCACACTACACAGGAGAGAG -3'
Posted On2015-02-19