Incidental Mutation 'R3684:Itih5'
ID 269457
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R3684 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 10238624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 391 (N391Y)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000026886
AA Change: N391Y

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: N391Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,775,699 Y54N probably damaging Het
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cep83 A G 10: 94,786,825 T588A probably benign Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Ppcdc C T 9: 57,421,125 probably null Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Zfp810 T C 9: 22,278,235 D459G probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9110:Itih5 UTSW 2 10187020 missense probably benign
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAAACGCTTGTCAGATTC -3'
(R):5'- CAGTTCTCCAGCGAGAGTTTC -3'

Sequencing Primer
(F):5'- GCTTGTCAGATTCTCAAAAAGTCACC -3'
(R):5'- TCCAGCGAGAGTTTCTCTAACAG -3'
Posted On 2015-02-19