Incidental Mutation 'R3684:Ppcdc'
ID269474
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Namephosphopantothenoylcysteine decarboxylase
Synonyms1810057I13Rik, 8430432M10Rik
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R3684 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location57385095-57440124 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 57421125 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000213479] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215299] [ENSMUST00000215883] [ENSMUST00000216365]
Predicted Effect probably null
Transcript: ENSMUST00000085709
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213194
Predicted Effect probably benign
Transcript: ENSMUST00000213479
Predicted Effect probably null
Transcript: ENSMUST00000214065
Predicted Effect probably null
Transcript: ENSMUST00000214144
Predicted Effect probably benign
Transcript: ENSMUST00000214166
Predicted Effect probably benign
Transcript: ENSMUST00000214339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214519
Predicted Effect probably benign
Transcript: ENSMUST00000214624
Predicted Effect probably benign
Transcript: ENSMUST00000215299
Predicted Effect probably benign
Transcript: ENSMUST00000215883
Predicted Effect probably null
Transcript: ENSMUST00000215961
Predicted Effect probably benign
Transcript: ENSMUST00000216365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217255
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,775,699 Y54N probably damaging Het
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cep83 A G 10: 94,786,825 T588A probably benign Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Zfp810 T C 9: 22,278,235 D459G probably benign Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57415140 missense probably benign 0.00
R0945:Ppcdc UTSW 9 57420158 splice site probably null
R1666:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4223:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4821:Ppcdc UTSW 9 57434911 missense probably benign 0.00
R5121:Ppcdc UTSW 9 57421163 missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57414654 missense probably benign 0.00
R7034:Ppcdc UTSW 9 57415170 missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57414675 missense probably benign
R7591:Ppcdc UTSW 9 57434979 missense probably damaging 1.00
R7835:Ppcdc UTSW 9 57420276 missense probably benign 0.02
R7918:Ppcdc UTSW 9 57420276 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGAGCTCTGCCTAAGGAAG -3'
(R):5'- TGAGGAGAGCATCTGCCTTC -3'

Sequencing Primer
(F):5'- CCTAAGGAAGGCGGTACCAC -3'
(R):5'- CTGTACTGGCCCTCATGTGG -3'
Posted On2015-02-19