Incidental Mutation 'R3684:Cep83'
ID269478
Institutional Source Beutler Lab
Gene Symbol Cep83
Ensembl Gene ENSMUSG00000020024
Gene Namecentrosomal protein 83
Synonyms4921537D05Rik, Ccdc41, 5730513H21Rik, 2600001G24Rik
MMRRC Submission 040682-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3684 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94688654-94790853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94786825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 588 (T588A)
Ref Sequence ENSEMBL: ENSMUSP00000020212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020212] [ENSMUST00000099337]
Predicted Effect probably benign
Transcript: ENSMUST00000020212
AA Change: T588A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020212
Gene: ENSMUSG00000020024
AA Change: T588A

DomainStartEndE-ValueType
coiled coil region 31 100 N/A INTRINSIC
coiled coil region 121 602 N/A INTRINSIC
coiled coil region 656 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218201
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a centriolar protein involved in primary cilium assembly. Defects in this gene have been associated with infantile nephronophthisis and intellectual disability. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A T 11: 97,775,699 Y54N probably damaging Het
Adamdec1 C T 14: 68,581,998 V17I probably benign Het
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atr T C 9: 95,920,400 S1782P probably damaging Het
Btbd9 T A 17: 30,334,307 N394Y probably damaging Het
Calb2 A G 8: 110,156,988 Y35H probably benign Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cfap126 T C 1: 171,114,031 S32P possibly damaging Het
Clcn7 T C 17: 25,150,593 L301P possibly damaging Het
Corin T C 5: 72,330,855 D610G probably damaging Het
Dok3 A G 13: 55,524,493 S154P probably damaging Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gldn G A 9: 54,338,340 E392K possibly damaging Het
Gls A T 1: 52,166,293 D447E probably damaging Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Jchain G A 5: 88,522,539 P74S probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lrrn1 T C 6: 107,567,949 V236A probably benign Het
Mcm3ap T C 10: 76,489,426 S954P possibly damaging Het
Myh11 T C 16: 14,203,234 N1725S probably benign Het
Ppcdc C T 9: 57,421,125 probably null Het
Rhobtb3 A G 13: 75,939,481 I129T probably damaging Het
Sfxn2 A G 19: 46,591,153 R252G probably benign Het
Sh2d2a C A 3: 87,851,720 probably null Het
Sh3gl1 T C 17: 56,018,953 K159E possibly damaging Het
Slc7a9 A G 7: 35,453,501 T115A probably benign Het
Synj2 A T 17: 6,028,443 D1020V probably damaging Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Tmem127 T A 2: 127,248,732 I56N possibly damaging Het
Traj7 A G 14: 54,211,481 probably benign Het
Unc5d A G 8: 28,694,592 F627L probably damaging Het
Unc79 T A 12: 103,074,803 N698K probably benign Het
Usp17la A T 7: 104,861,730 N514I possibly damaging Het
Uvrag A T 7: 98,988,220 C341S probably damaging Het
Zfp810 T C 9: 22,278,235 D459G probably benign Het
Other mutations in Cep83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Cep83 APN 10 94789764 missense possibly damaging 0.77
IGL00912:Cep83 APN 10 94737866 nonsense probably null
IGL01141:Cep83 APN 10 94788757 missense probably benign 0.39
R0358:Cep83 UTSW 10 94719731 missense probably benign
R0530:Cep83 UTSW 10 94719588 splice site probably benign
R0579:Cep83 UTSW 10 94749053 missense possibly damaging 0.58
R1140:Cep83 UTSW 10 94737890 missense probably damaging 1.00
R1573:Cep83 UTSW 10 94788663 missense probably damaging 1.00
R1756:Cep83 UTSW 10 94750267 missense probably damaging 1.00
R3121:Cep83 UTSW 10 94786838 missense probably damaging 1.00
R5115:Cep83 UTSW 10 94768889 missense probably benign
R5325:Cep83 UTSW 10 94737906 missense probably damaging 0.98
R5439:Cep83 UTSW 10 94789738 missense probably benign 0.03
R5782:Cep83 UTSW 10 94749032 missense probably damaging 1.00
R5891:Cep83 UTSW 10 94725675 missense probably benign 0.12
R7229:Cep83 UTSW 10 94719665 missense probably damaging 1.00
R7632:Cep83 UTSW 10 94750640 missense probably damaging 1.00
R8043:Cep83 UTSW 10 94737942 missense probably damaging 0.99
R8167:Cep83 UTSW 10 94728717 missense possibly damaging 0.56
R8171:Cep83 UTSW 10 94768935 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAAAGTGCCTTAAGTATCCACCATC -3'
(R):5'- TACAGTGAGCTCAGAAACAAAGTGC -3'

Sequencing Primer
(F):5'- GGAAATTATGTATCAGCGTAC -3'
(R):5'- GCTTTTCCAAAGGACCAGTG -3'
Posted On2015-02-19