Incidental Mutation 'R3685:Trim34a'
ID269501
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Nametripartite motif-containing 34A
SynonymsTrim34-1, Trim34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3685 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104244457-104262234 bp(+) (GRCm38)
Type of Mutationunclassified (3260 bp from exon)
DNA Base Change (assembly) T to C at 104260126 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect probably benign
Transcript: ENSMUST00000060315
AA Change: I260T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: I260T

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098179
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106848
AA Change: I260T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: I260T

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106849
AA Change: I260T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: I260T

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217156
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atp13a5 G C 16: 29,316,755 L340V probably damaging Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cyp2c40 A G 19: 39,786,779 M343T possibly damaging Het
Dmrtc2 T C 7: 24,874,262 V174A probably benign Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gm9637 A G 14: 19,401,950 noncoding transcript Het
Gpbp1 T C 13: 111,466,871 T15A probably benign Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Klhl40 A G 9: 121,782,658 E579G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Prr16 C A 18: 51,302,820 P124T probably damaging Het
Ribc2 A G 15: 85,135,334 T106A possibly damaging Het
Slc37a1 C A 17: 31,325,693 T253N probably benign Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 unclassified probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 unclassified probably null
gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 unclassified probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5443:Trim34a UTSW 7 104260213 missense possibly damaging 0.80
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGAACATTTCACAGAGCCCTG -3'
(R):5'- TTAAAGGTCCTCTCTGGTAAGC -3'

Sequencing Primer
(F):5'- CTGTGGCTTCTGATTCACAGTCAG -3'
(R):5'- AGAACACTTTAGGGTGCTCC -3'
Posted On2015-02-19