Incidental Mutation 'R3685:Klhl40'
ID269505
Institutional Source Beutler Lab
Gene Symbol Klhl40
Ensembl Gene ENSMUSG00000074001
Gene Namekelch-like 40
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3685 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location121777607-121783818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121782658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 579 (E579G)
Ref Sequence ENSEMBL: ENSMUSP00000095873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981]
Predicted Effect probably benign
Transcript: ENSMUST00000035110
SMART Domains Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
Pfam:MBOAT 63 448 2.7e-15 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098272
AA Change: E579G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001
AA Change: E579G

DomainStartEndE-ValueType
BTB 33 128 4.61e-29 SMART
BACK 133 239 9.46e-30 SMART
low complexity region 262 276 N/A INTRINSIC
Blast:BTB 300 355 2e-27 BLAST
Kelch 360 412 1.77e0 SMART
Kelch 413 462 1.29e-2 SMART
Kelch 463 510 4.68e-9 SMART
Kelch 511 557 2.06e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163981
SMART Domains Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Pfam:MBOAT 97 444 3.7e-16 PFAM
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216358
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a BACK domain, a BTB/POZ domain, and 5 Kelch repeats, however, its exact function is not known. The gene and the multi-domain protein structure are conserved across different taxa, including primates, rodents, chicken and zebrafish. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous disruption of this gene results in postnatal growth retardation, abnormal sarcomere morphology, skeletal muscle dysfunction, and complete postnatal lethality. Homozygotes for a null allele develop a nemaline-like myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atp13a5 G C 16: 29,316,755 L340V probably damaging Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cyp2c40 A G 19: 39,786,779 M343T possibly damaging Het
Dmrtc2 T C 7: 24,874,262 V174A probably benign Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gm9637 A G 14: 19,401,950 noncoding transcript Het
Gpbp1 T C 13: 111,466,871 T15A probably benign Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Prr16 C A 18: 51,302,820 P124T probably damaging Het
Ribc2 A G 15: 85,135,334 T106A possibly damaging Het
Slc37a1 C A 17: 31,325,693 T253N probably benign Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Trim34a T C 7: 104,260,126 probably null Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Other mutations in Klhl40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Klhl40 APN 9 121778917 missense probably damaging 1.00
IGL02123:Klhl40 APN 9 121779923 missense probably benign 0.01
IGL03059:Klhl40 APN 9 121778137 missense probably damaging 1.00
IGL03124:Klhl40 APN 9 121780685 missense probably damaging 1.00
IGL03204:Klhl40 APN 9 121782630 missense probably benign 0.03
IGL03366:Klhl40 APN 9 121783380 missense probably damaging 1.00
R0506:Klhl40 UTSW 9 121778067 missense probably damaging 0.98
R1735:Klhl40 UTSW 9 121779938 missense probably benign 0.00
R2430:Klhl40 UTSW 9 121780601 missense possibly damaging 0.57
R3839:Klhl40 UTSW 9 121780416 missense possibly damaging 0.93
R3929:Klhl40 UTSW 9 121780676 missense probably benign
R4326:Klhl40 UTSW 9 121778890 missense probably benign 0.37
R4328:Klhl40 UTSW 9 121778890 missense probably benign 0.37
R4664:Klhl40 UTSW 9 121780733 missense probably damaging 1.00
R4697:Klhl40 UTSW 9 121778734 missense probably damaging 1.00
R5228:Klhl40 UTSW 9 121777801 missense probably benign 0.02
R6198:Klhl40 UTSW 9 121778767 missense probably damaging 1.00
R6258:Klhl40 UTSW 9 121777960 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTGGACTGCTTACTTC -3'
(R):5'- TCTTCTAGACAAAGCACCTCAG -3'

Sequencing Primer
(F):5'- GGACTGCTTACTTCTACTCCCAC -3'
(R):5'- AACAGACTCTGGGCCTAAGCTG -3'
Posted On2015-02-19