Mutagenetix > Incidental Mutations

Incidental Mutation 'R3685:Klhl40'

269505

Institutional Source

Beutler Lab

Gene Symbol

Klhl40

Ensembl Gene

ENSMUSG00000074001

Gene Name

kelch-like 40

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R3685 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121777607-121783818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121782658 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 579 (E579G)

Ref Sequence

ENSEMBL: ENSMUSP00000095873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035110] [ENSMUST00000098272] [ENSMUST00000163981]

Predicted Effect

probably benign
Transcript: ENSMUST00000035110

SMART Domains

Protein: ENSMUSP00000035110
Gene: ENSMUSG00000032523

Domain	Start	End	E-Value	Type
transmembrane domain	12	31	N/A	INTRINSIC
Pfam:MBOAT	63	448	2.7e-15	PFAM
transmembrane domain	460	482	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098272
AA Change: E579G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095873
Gene: ENSMUSG00000074001
AA Change: E579G

Domain	Start	End	E-Value	Type
BTB	33	128	4.61e-29	SMART
BACK	133	239	9.46e-30	SMART
low complexity region	262	276	N/A	INTRINSIC
Blast:BTB	300	355	2e-27	BLAST
Kelch	360	412	1.77e0	SMART
Kelch	413	462	1.29e-2	SMART
Kelch	463	510	4.68e-9	SMART
Kelch	511	557	2.06e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163981

SMART Domains

Protein: ENSMUSP00000131971
Gene: ENSMUSG00000032523

Domain	Start	End	E-Value	Type
transmembrane domain	12	31	N/A	INTRINSIC
transmembrane domain	65	87	N/A	INTRINSIC
Pfam:MBOAT	97	444	3.7e-16	PFAM
transmembrane domain	460	482	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215257

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216358

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a BACK domain, a BTB/POZ domain, and 5 Kelch repeats, however, its exact function is not known. The gene and the multi-domain protein structure are conserved across different taxa, including primates, rodents, chicken and zebrafish. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous disruption of this gene results in postnatal growth retardation, abnormal sarcomere morphology, skeletal muscle dysfunction, and complete postnatal lethality. Homozygotes for a null allele develop a nemaline-like myopathy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahdc1	T	C	4: 133,065,702	L1418P	possibly damaging	Het
Atp13a5	G	C	16: 29,316,755	L340V	probably damaging	Het
Cdon	A	G	9: 35,489,032	E1014G	possibly damaging	Het
Cyp2c40	A	G	19: 39,786,779	M343T	possibly damaging	Het
Dmrtc2	T	C	7: 24,874,262	V174A	probably benign	Het
Ggta1	T	A	2: 35,407,988	T162S	probably benign	Het
Gm9637	A	G	14: 19,401,950		noncoding transcript	Het
Gpbp1	T	C	13: 111,466,871	T15A	probably benign	Het
Itih5	A	T	2: 10,238,624	N391Y	possibly damaging	Het
Olfr1164	T	A	2: 88,093,259	I226F	probably damaging	Het
Olfr1223	A	T	2: 89,145,020	M1K	probably null	Het
Olfr1246	C	A	2: 89,590,755	R120L	probably damaging	Het
Prr16	C	A	18: 51,302,820	P124T	probably damaging	Het
Ribc2	A	G	15: 85,135,334	T106A	possibly damaging	Het
Slc37a1	C	A	17: 31,325,693	T253N	probably benign	Het
Smpd1	T	A	7: 105,555,402	C163S	probably damaging	Het
Tacc2	A	G	7: 130,625,070	S1162G	probably benign	Het
Tenm2	C	A	11: 36,051,817	V1342L	probably benign	Het
Trim34a	T	C	7: 104,260,126		probably null	Het
Zfand6	G	A	7: 84,634,362	P11S	probably damaging	Het

Other mutations in Klhl40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Klhl40	APN	9	121778917	missense	probably damaging	1.00
IGL02123:Klhl40	APN	9	121779923	missense	probably benign	0.01
IGL03059:Klhl40	APN	9	121778137	missense	probably damaging	1.00
IGL03124:Klhl40	APN	9	121780685	missense	probably damaging	1.00
IGL03204:Klhl40	APN	9	121782630	missense	probably benign	0.03
IGL03366:Klhl40	APN	9	121783380	missense	probably damaging	1.00
R0506:Klhl40	UTSW	9	121778067	missense	probably damaging	0.98
R1735:Klhl40	UTSW	9	121779938	missense	probably benign	0.00
R2430:Klhl40	UTSW	9	121780601	missense	possibly damaging	0.57
R3839:Klhl40	UTSW	9	121780416	missense	possibly damaging	0.93
R3929:Klhl40	UTSW	9	121780676	missense	probably benign
R4326:Klhl40	UTSW	9	121778890	missense	probably benign	0.37
R4328:Klhl40	UTSW	9	121778890	missense	probably benign	0.37
R4664:Klhl40	UTSW	9	121780733	missense	probably damaging	1.00
R4697:Klhl40	UTSW	9	121778734	missense	probably damaging	1.00
R5228:Klhl40	UTSW	9	121777801	missense	probably benign	0.02
R6198:Klhl40	UTSW	9	121778767	missense	probably damaging	1.00
R6258:Klhl40	UTSW	9	121777960	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCTGGACTGCTTACTTC -3'
(R):5'- TCTTCTAGACAAAGCACCTCAG -3'

Sequencing Primer
(F):5'- GGACTGCTTACTTCTACTCCCAC -3'
(R):5'- AACAGACTCTGGGCCTAAGCTG -3'

Posted On

2015-02-19