Incidental Mutation 'R3685:Prr16'
ID269513
Institutional Source Beutler Lab
Gene Symbol Prr16
Ensembl Gene ENSMUSG00000073565
Gene Nameproline rich 16
Synonyms5430406M13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3685 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location51117898-51304641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 51302820 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 124 (P124T)
Ref Sequence ENSEMBL: ENSMUSP00000112338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116639]
Predicted Effect probably damaging
Transcript: ENSMUST00000116639
AA Change: P124T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112338
Gene: ENSMUSG00000073565
AA Change: P124T

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:DUF4589 53 304 4.4e-80 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atp13a5 G C 16: 29,316,755 L340V probably damaging Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cyp2c40 A G 19: 39,786,779 M343T possibly damaging Het
Dmrtc2 T C 7: 24,874,262 V174A probably benign Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gm9637 A G 14: 19,401,950 noncoding transcript Het
Gpbp1 T C 13: 111,466,871 T15A probably benign Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Klhl40 A G 9: 121,782,658 E579G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Olfr1246 C A 2: 89,590,755 R120L probably damaging Het
Ribc2 A G 15: 85,135,334 T106A possibly damaging Het
Slc37a1 C A 17: 31,325,693 T253N probably benign Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Trim34a T C 7: 104,260,126 probably null Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Other mutations in Prr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Prr16 APN 18 51303120 missense possibly damaging 0.82
IGL00951:Prr16 APN 18 51303339 missense probably damaging 1.00
IGL01744:Prr16 APN 18 51302989 missense possibly damaging 0.73
IGL02345:Prr16 APN 18 51303229 missense probably damaging 1.00
IGL02833:Prr16 APN 18 51303092 missense probably damaging 1.00
LCD18:Prr16 UTSW 18 51200324 intron probably benign
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1572:Prr16 UTSW 18 51302970 missense probably benign 0.01
R1988:Prr16 UTSW 18 51303277 missense probably damaging 1.00
R3436:Prr16 UTSW 18 51303123 missense probably benign 0.00
R4609:Prr16 UTSW 18 51118067 missense possibly damaging 0.79
R4626:Prr16 UTSW 18 51302839 missense probably damaging 1.00
R5443:Prr16 UTSW 18 51303153 missense probably damaging 1.00
R5713:Prr16 UTSW 18 51302838 missense probably damaging 1.00
R6525:Prr16 UTSW 18 51303155 missense probably benign 0.01
Z1176:Prr16 UTSW 18 51303150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTGACACCCTGACCTC -3'
(R):5'- TGTGCATCAGAGACTGCAAC -3'

Sequencing Primer
(F):5'- CCTCTGATCTACAGCTGGAAGATG -3'
(R):5'- ACGGAGCCTTGTCCAAGTTACTG -3'
Posted On2015-02-19