Incidental Mutation 'R3686:Sycp2'
ID269517
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178374384 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 762 (T762A)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect probably benign
Transcript: ENSMUST00000081134
AA Change: T762A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: T762A

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132765
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
R8022:Sycp2 UTSW 2 178355062 missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178374585 missense probably benign 0.05
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Z1176:Sycp2 UTSW 2 178364881 missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178380875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCTGTACACCAATCTCG -3'
(R):5'- TCAAGTGTAACAAGTCAGATGAAGC -3'

Sequencing Primer
(F):5'- ACCAATCTCGTTCCACAAGTCTG -3'
(R):5'- CAAGTCAGATGAAGCAGAATTTTGTG -3'
Posted On2015-02-19