Mutagenetix > Incidental Mutation

Incidental Mutation 'R3686:Cdh4'

269518

Institutional Source

Beutler Lab

Gene Symbol

Cdh4

Ensembl Gene

ENSMUSG00000000305

Gene Name

cadherin 4

Synonyms

R-Cadh, Rcad, R-cadherin

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3686 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

179442431-179899373 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 179780367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 95 (S95P)

Ref Sequence

ENSEMBL: ENSMUSP00000104539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000314] [ENSMUST00000108911]

AlphaFold

P39038

Predicted Effect

probably benign
Transcript: ENSMUST00000000314
AA Change: S95P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305
AA Change: S95P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Cadherin_pro	30	121	1.18e-30	SMART
CA	187	272	2.31e-15	SMART
CA	296	387	4.33e-29	SMART
CA	410	503	2.21e-12	SMART
CA	526	610	7.16e-21	SMART
CA	630	715	3.78e-2	SMART
transmembrane domain	730	752	N/A	INTRINSIC
Pfam:Cadherin_C	760	909	2.5e-52	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108911
AA Change: S95P

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000104539
Gene: ENSMUSG00000000305
AA Change: S95P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Cadherin_pro	30	121	1.18e-30	SMART
CA	187	272	2.31e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136411

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asb16	T	A	11: 102,269,059	D79E	probably benign	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
B230307C23Rik	T	A	16: 98,008,999	N62K	probably benign	Het
B3galnt2	G	A	13: 13,975,635		probably null	Het
Bnip2	T	A	9: 69,999,150	Y118N	probably damaging	Het
Bptf	C	A	11: 107,074,198	R1275L	probably benign	Het
Cacna1g	T	C	11: 94,459,090		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Ceacam5	G	A	7: 17,760,823	E919K	possibly damaging	Het
Eftud2	T	C	11: 102,844,201	E624G	probably damaging	Het
Hr	T	A	14: 70,557,796	N289K	probably damaging	Het
Hsp90ab1	A	G	17: 45,569,288	Y110H	probably damaging	Het
Map3k1	A	G	13: 111,753,891	V1258A	probably damaging	Het
Naa11	A	T	5: 97,391,789	V170E	probably benign	Het
Nmd3	C	T	3: 69,746,762	R413C	probably damaging	Het
Olfr1301	G	T	2: 111,754,569	V107F	probably benign	Het
Olfr661	A	G	7: 104,688,392	I126V	probably benign	Het
Pgm3	G	T	9: 86,559,510	P345T	probably benign	Het
Ptpn14	C	A	1: 189,851,399	D814E	probably damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Ros1	A	T	10: 52,145,816	V624E	probably damaging	Het
Sgo2b	T	C	8: 63,931,327	K212E	probably benign	Het
Shisa2	T	A	14: 59,629,779	L160Q	probably damaging	Het
Strn4	A	G	7: 16,822,581	Y123C	probably damaging	Het
Sycp2	T	C	2: 178,374,384	T762A	probably benign	Het
Tiam2	A	G	17: 3,421,684	K534E	possibly damaging	Het
Trdn	A	T	10: 33,468,189	D633V	probably benign	Het
Ttn	T	C	2: 76,916,989	Y4572C	possibly damaging	Het
Unc79	T	A	12: 103,088,661	N921K	probably damaging	Het
Vmn2r66	A	G	7: 84,995,189	V671A	probably damaging	Het
Wdr86	T	A	5: 24,718,341	T118S	probably damaging	Het
Zfp446	T	A	7: 12,982,653	I517N	probably damaging	Het
Zfp830	G	A	11: 82,765,362	E331K	possibly damaging	Het

Other mutations in Cdh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdh4	APN	2	179874144	missense	probably damaging	1.00
IGL01411:Cdh4	APN	2	179780403	missense	probably damaging	0.96
IGL01752:Cdh4	APN	2	179890884	missense	probably damaging	1.00
IGL02814:Cdh4	APN	2	179780474	missense	probably benign	0.01
R0082:Cdh4	UTSW	2	179894188	missense	possibly damaging	0.75
R0357:Cdh4	UTSW	2	179847340	missense	probably damaging	1.00
R1521:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R1591:Cdh4	UTSW	2	179886864	critical splice donor site	probably null
R1622:Cdh4	UTSW	2	179889092	missense	possibly damaging	0.56
R1762:Cdh4	UTSW	2	179797480	missense	probably benign	0.01
R1794:Cdh4	UTSW	2	179886842	missense	probably damaging	1.00
R2275:Cdh4	UTSW	2	179890847	missense	probably damaging	1.00
R2277:Cdh4	UTSW	2	179797524	missense	possibly damaging	0.88
R3861:Cdh4	UTSW	2	179874097	missense	probably damaging	1.00
R4078:Cdh4	UTSW	2	179889173	missense	possibly damaging	0.93
R4495:Cdh4	UTSW	2	179780389	missense	probably damaging	0.98
R4715:Cdh4	UTSW	2	179780467	missense	probably benign	0.03
R4893:Cdh4	UTSW	2	179847419	intron	probably benign
R5029:Cdh4	UTSW	2	179881949	missense	possibly damaging	0.93
R5363:Cdh4	UTSW	2	179886763	missense	probably benign
R5542:Cdh4	UTSW	2	179860226	missense	probably damaging	0.98
R5773:Cdh4	UTSW	2	179885996	missense	probably damaging	1.00
R5791:Cdh4	UTSW	2	179895767	missense	probably damaging	1.00
R6262:Cdh4	UTSW	2	179797626	missense	probably damaging	1.00
R6338:Cdh4	UTSW	2	179890812	missense	probably damaging	1.00
R6589:Cdh4	UTSW	2	179881996	critical splice donor site	probably null
R6607:Cdh4	UTSW	2	179874096	missense	probably benign	0.00
R6653:Cdh4	UTSW	2	179780428	missense	probably benign	0.34
R6711:Cdh4	UTSW	2	179890931	missense	probably damaging	1.00
R6744:Cdh4	UTSW	2	179847387	missense	possibly damaging	0.68
R6824:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R6901:Cdh4	UTSW	2	179860194	missense	probably benign	0.19
R6981:Cdh4	UTSW	2	179797504	missense	probably benign	0.28
R7285:Cdh4	UTSW	2	179797465	missense	probably benign	0.00
R7514:Cdh4	UTSW	2	179890843	missense	possibly damaging	0.91
R7541:Cdh4	UTSW	2	179444810	splice site	probably null
R7560:Cdh4	UTSW	2	179890902	missense	probably benign	0.25
R8146:Cdh4	UTSW	2	179874078	missense	possibly damaging	0.91
R8833:Cdh4	UTSW	2	179894035	missense	possibly damaging	0.61
R9075:Cdh4	UTSW	2	179860147	missense	probably damaging	0.97
R9203:Cdh4	UTSW	2	179780403	missense	probably damaging	0.96
Z1177:Cdh4	UTSW	2	179780326	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- GAACCAGATGCTGTGCTTGTG -3'
(R):5'- AACCCGCATCTTCCATGAGTC -3'

Sequencing Primer
(F):5'- GTTGCAGCCTTCTGTCTGCTG -3'
(R):5'- TCCATGAGTCAGGGAAAGGCTC -3'

Posted On

2015-02-19