Incidental Mutation 'R3686:Naa11'
ID269521
Institutional Source Beutler Lab
Gene Symbol Naa11
Ensembl Gene ENSMUSG00000046000
Gene NameN(alpha)-acetyltransferase 11, NatA catalytic subunit
SynonymsArd1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location97382198-97392379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97391789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 170 (V170E)
Ref Sequence ENSEMBL: ENSMUSP00000057336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060265]
Predicted Effect probably benign
Transcript: ENSMUST00000060265
AA Change: V170E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000057336
Gene: ENSMUSG00000046000
AA Change: V170E

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 32 125 2.7e-8 PFAM
Pfam:Acetyltransf_7 40 129 1.5e-9 PFAM
Pfam:Acetyltransf_1 46 129 1.4e-18 PFAM
Pfam:FR47 56 137 1.1e-9 PFAM
low complexity region 195 206 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181724
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Naa11
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4469001:Naa11 UTSW 5 97391626 critical splice donor site probably null
R2567:Naa11 UTSW 5 97391759 missense probably benign
R4004:Naa11 UTSW 5 97391793 missense probably benign
R6268:Naa11 UTSW 5 97392210 missense probably damaging 1.00
R7687:Naa11 UTSW 5 97391789 missense probably benign 0.00
R8310:Naa11 UTSW 5 97391878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCCAAGCTATGACTCAAAGG -3'
(R):5'- TGCACGTCAGGAAGAGCAAC -3'

Sequencing Primer
(F):5'- CCAAGCTATGACTCAAAGGGGTAC -3'
(R):5'- AGAGCAACAGGGCGGCC -3'
Posted On2015-02-19