Incidental Mutation 'R3686:Zfp446'
ID269522
Institutional Source Beutler Lab
Gene Symbol Zfp446
Ensembl Gene ENSMUSG00000033961
Gene Namezinc finger protein 446
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12977848-12985714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12982653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 517 (I517N)
Ref Sequence ENSEMBL: ENSMUSP00000039073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045810] [ENSMUST00000108535] [ENSMUST00000108536] [ENSMUST00000108537]
Predicted Effect probably damaging
Transcript: ENSMUST00000045810
AA Change: I517N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961
AA Change: I517N

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108535
SMART Domains Protein: ENSMUSP00000104175
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 254 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
AA Change: I417N

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961
AA Change: I417N

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108537
AA Change: I342N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104177
Gene: ENSMUSG00000033961
AA Change: I342N

DomainStartEndE-ValueType
SCAN 22 128 7.37e-49 SMART
KRAB 124 185 3.96e-2 SMART
ZnF_C2H2 244 266 2.95e-3 SMART
ZnF_C2H2 293 315 8.47e-4 SMART
ZnF_C2H2 321 343 5.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147996
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Zfp446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Zfp446 APN 7 12979380 critical splice donor site probably null
IGL01534:Zfp446 APN 7 12979566 missense probably damaging 1.00
IGL02471:Zfp446 APN 7 12982254 missense probably benign 0.41
IGL02888:Zfp446 APN 7 12979328 missense probably damaging 1.00
IGL03153:Zfp446 APN 7 12977907 missense probably benign 0.01
IGL03185:Zfp446 APN 7 12978998 missense probably null 0.43
IGL03242:Zfp446 APN 7 12979325 missense probably damaging 1.00
R0538:Zfp446 UTSW 7 12979589 missense possibly damaging 0.94
R1809:Zfp446 UTSW 7 12979121 missense probably damaging 1.00
R3701:Zfp446 UTSW 7 12978152 unclassified probably benign
R5256:Zfp446 UTSW 7 12979304 nonsense probably null
R5363:Zfp446 UTSW 7 12978057 missense probably benign 0.20
R5377:Zfp446 UTSW 7 12982251 missense possibly damaging 0.88
R6806:Zfp446 UTSW 7 12979116 missense probably damaging 1.00
R7167:Zfp446 UTSW 7 12978122 unclassified probably benign
Z1177:Zfp446 UTSW 7 12978166 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGAGACCATCACAGGTG -3'
(R):5'- AAGGGACTAGCCTCTTCTCCTTAC -3'

Sequencing Primer
(F):5'- ACCATCACAGGTGGCCCG -3'
(R):5'- CTCCTTACACTGGATAGTCTGGTG -3'
Posted On2015-02-19