Incidental Mutation 'R3686:Ceacam5'
ID269524
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 5
SynonymsPsg30, 1600029H12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location17713238-17761132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17760823 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 919 (E919K)
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081907
AA Change: E919K

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: E919K

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17759556 nonsense probably null
IGL00981:Ceacam5 APN 7 17745533 missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17747256 nonsense probably null
IGL01329:Ceacam5 APN 7 17745609 missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17747375 missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17745599 missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17759434 missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17750812 missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17760728 missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17715131 missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17745379 splice site probably benign
IGL03054:Ceacam5 UTSW 7 17759454 missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17760851 missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17714963 missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17757837 missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17757702 missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17747344 missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17752165 missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17747234 missense probably damaging 1.00
R1526:Ceacam5 UTSW 7 17750695 missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17747395 missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17714910 nonsense probably null
R1907:Ceacam5 UTSW 7 17752384 missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17759577 nonsense probably null
R1990:Ceacam5 UTSW 7 17757880 missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17747247 missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17747375 missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17745635 missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17747323 missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17757637 missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17714976 missense probably benign 0.06
R3713:Ceacam5 UTSW 7 17759338 missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17750581 missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17752151 missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17752129 missense probably benign
R4725:Ceacam5 UTSW 7 17760677 missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17757744 missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17752258 missense probably benign
R4986:Ceacam5 UTSW 7 17757833 missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17745588 missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17759548 missense probably damaging 0.98
R5522:Ceacam5 UTSW 7 17715080 missense probably benign
R5605:Ceacam5 UTSW 7 17747236 missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17714885 missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17745547 missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17747198 missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17747466 critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17750831 critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17745491 missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17713447 start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17752287 nonsense probably null
R6872:Ceacam5 UTSW 7 17752287 nonsense probably null
R6930:Ceacam5 UTSW 7 17750834 splice site probably null
R7071:Ceacam5 UTSW 7 17750652 missense possibly damaging 0.49
R7121:Ceacam5 UTSW 7 17745537 missense probably benign 0.29
R7174:Ceacam5 UTSW 7 17757914 critical splice donor site probably null
R7187:Ceacam5 UTSW 7 17759485 missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17747387 missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17750753 missense probably damaging 0.99
R7462:Ceacam5 UTSW 7 17760839 missense probably damaging 1.00
R7612:Ceacam5 UTSW 7 17759416 missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17759392 missense probably damaging 0.98
X0020:Ceacam5 UTSW 7 17760909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGACCCTGTTTCATGGC -3'
(R):5'- AGGCAGTACTTGAGTGGTAACTG -3'

Sequencing Primer
(F):5'- CCTTTTGTGCGAGTGACTGAC -3'
(R):5'- CAGTACTTGAGTGGTAACTGACAAC -3'
Posted On2015-02-19