Incidental Mutation 'R3686:B3galnt2'
ID269542
Institutional Source Beutler Lab
Gene Symbol B3galnt2
Ensembl Gene ENSMUSG00000039242
Gene NameUDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
SynonymsD230016N13Rik, A930105D20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location13954469-13999103 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 13975635 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099747] [ENSMUST00000221300] [ENSMUST00000221974] [ENSMUST00000222110] [ENSMUST00000223483]
Predicted Effect probably null
Transcript: ENSMUST00000099747
SMART Domains Protein: ENSMUSP00000097336
Gene: ENSMUSG00000039242

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Galactosyl_T 300 460 2.9e-26 PFAM
low complexity region 481 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221021
Predicted Effect probably null
Transcript: ENSMUST00000221300
Predicted Effect probably null
Transcript: ENSMUST00000221333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221764
Predicted Effect probably null
Transcript: ENSMUST00000221974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222015
Predicted Effect probably benign
Transcript: ENSMUST00000222110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223389
Predicted Effect probably benign
Transcript: ENSMUST00000223483
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 31 family. The encoded protein synthesizes GalNAc:beta-1,3GlcNAc, a novel carbohydrate structure, on N- and O-glycans. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in B3galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:B3galnt2 APN 13 13987431 missense probably benign 0.15
IGL01149:B3galnt2 APN 13 13980685 missense probably benign 0.07
IGL01814:B3galnt2 APN 13 13987353 missense probably damaging 1.00
IGL02383:B3galnt2 APN 13 13997033 makesense probably null
R0106:B3galnt2 UTSW 13 13995793 missense probably benign
R0349:B3galnt2 UTSW 13 13991474 missense probably benign
R0676:B3galnt2 UTSW 13 13995793 missense probably benign
R1522:B3galnt2 UTSW 13 13970769 missense probably damaging 1.00
R1830:B3galnt2 UTSW 13 13991534 nonsense probably null
R2035:B3galnt2 UTSW 13 13966324 missense probably benign 0.10
R3954:B3galnt2 UTSW 13 13966454 missense probably benign 0.04
R5369:B3galnt2 UTSW 13 13994425 splice site probably null
R5435:B3galnt2 UTSW 13 13996990 missense probably benign 0.01
R5564:B3galnt2 UTSW 13 13995229 missense probably damaging 1.00
R5628:B3galnt2 UTSW 13 13995152 splice site probably null
R6118:B3galnt2 UTSW 13 13991509 missense probably damaging 0.96
R6396:B3galnt2 UTSW 13 13995748 missense probably damaging 1.00
R6529:B3galnt2 UTSW 13 13995792 missense probably benign 0.00
R6656:B3galnt2 UTSW 13 13975576 missense probably benign 0.00
R7345:B3galnt2 UTSW 13 13980480 splice site probably null
R7439:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7441:B3galnt2 UTSW 13 13994485 missense probably benign 0.34
R7582:B3galnt2 UTSW 13 13991401 missense probably damaging 1.00
R7849:B3galnt2 UTSW 13 13994492 missense probably benign 0.15
R8135:B3galnt2 UTSW 13 13970869 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCTTTCCTGAAGATGCCTCC -3'
(R):5'- CTGGGAATTTCTAGTCCAGTCC -3'

Sequencing Primer
(F):5'- CTCATCTAGACTCTCTGAAGACCGAG -3'
(R):5'- GGGAATTTCTAGTCCAGTCCAACTG -3'
Posted On2015-02-19