Incidental Mutation 'R3687:Galnt13'
ID269553
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
MMRRC Submission 040683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R3687 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54880062 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 289 (T289S)
Ref Sequence ENSEMBL: ENSMUSP00000108255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]
Predicted Effect probably benign
Transcript: ENSMUST00000068595
AA Change: T289S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: T289S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112634
AA Change: T289S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: T289S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112635
AA Change: T289S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: T289S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112636
AA Change: T289S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: T289S

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Meta Mutation Damage Score 0.2468 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,852,590 V115M probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
C2cd3 C T 7: 100,435,833 P1544L probably benign Het
Cd44 G A 2: 102,901,350 probably null Het
Col10a1 A G 10: 34,395,498 T489A probably benign Het
Dgkk T C X: 6,938,392 probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Elmo3 G A 8: 105,308,836 probably null Het
Gm16485 T C 9: 8,972,381 probably benign Het
Gm43302 A T 5: 105,280,266 V143D probably damaging Het
Gpr18 T C 14: 121,912,461 T51A probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Ighv1-24 T A 12: 114,773,080 I67F probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Myo3b A G 2: 70,245,314 E554G probably benign Het
Olfr1451 G A 19: 12,999,102 G39R probably damaging Het
Olfr819 A T 10: 129,966,712 probably null Het
Olfr888 A G 9: 38,108,881 Y60C probably damaging Het
Pclo A G 5: 14,668,995 T1049A unknown Het
Pkhd1l1 T C 15: 44,546,587 S2497P probably benign Het
Ppm1f T C 16: 16,923,883 V407A probably damaging Het
Ppox A G 1: 171,277,493 L374S probably damaging Het
Prkdc T C 16: 15,799,967 Y3221H probably benign Het
Ptprk A T 10: 28,473,043 I520F probably damaging Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3d A T 9: 21,914,908 M101K probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Tas2r114 T C 6: 131,689,268 T266A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trem3 T A 17: 48,257,927 V152D probably damaging Het
Vmn2r4 T A 3: 64,389,475 I630F possibly damaging Het
Vwa5b2 C A 16: 20,591,558 probably benign Het
Zfp518b A T 5: 38,674,112 H183Q probably damaging Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
G1patch:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1509:Galnt13 UTSW 2 54733082 missense probably damaging 1.00
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
R7448:Galnt13 UTSW 2 54516564 missense possibly damaging 0.94
R7635:Galnt13 UTSW 2 54857817 missense probably damaging 1.00
R7889:Galnt13 UTSW 2 55112861 missense probably benign 0.02
R8003:Galnt13 UTSW 2 55060485 nonsense probably null
R8207:Galnt13 UTSW 2 54880110 missense probably benign 0.00
R8525:Galnt13 UTSW 2 55060476 missense possibly damaging 0.95
R8539:Galnt13 UTSW 2 54933572 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACCTGCAGATTTAACTAGGCATTG -3'
(R):5'- GGTGTGATAGATGCATGCTACC -3'

Sequencing Primer
(F):5'- AACTAGGCATTGTTTCTTCAGTG -3'
(R):5'- GCATGCTACCATATACTATGTTCAG -3'
Posted On2015-02-19