Incidental Mutation 'R3687:Elmo3'
ID269566
Institutional Source Beutler Lab
Gene Symbol Elmo3
Ensembl Gene ENSMUSG00000014791
Gene Nameengulfment and cell motility 3
SynonymsCED-12
MMRRC Submission 040683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3687 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105305601-105310760 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 105308836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000070508] [ENSMUST00000109375] [ENSMUST00000209964] [ENSMUST00000210412] [ENSMUST00000210801] [ENSMUST00000211199] [ENSMUST00000212033] [ENSMUST00000212033] [ENSMUST00000212046]
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070508
SMART Domains Protein: ENSMUSP00000063248
Gene: ENSMUSG00000041679

DomainStartEndE-ValueType
LRR 42 67 7.15e-2 SMART
LRR 68 93 1.92e-2 SMART
LRR 94 119 1.23e0 SMART
LRR 120 145 1.56e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably null
Transcript: ENSMUST00000109375
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably benign
Transcript: ENSMUST00000209964
Predicted Effect probably benign
Transcript: ENSMUST00000210412
Predicted Effect probably benign
Transcript: ENSMUST00000210801
Predicted Effect probably benign
Transcript: ENSMUST00000211199
Predicted Effect probably null
Transcript: ENSMUST00000212033
Predicted Effect probably null
Transcript: ENSMUST00000212033
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a C. elegans protein that functions in phagocytosis of apoptotic cells and in cell migration. Other members of this small family of engulfment and cell motility (ELMO) proteins have been shown to interact with the dedicator of cyto-kinesis 1 protein to promote phagocytosis and effect cell shape changes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,852,590 V115M probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
C2cd3 C T 7: 100,435,833 P1544L probably benign Het
Cd44 G A 2: 102,901,350 probably null Het
Col10a1 A G 10: 34,395,498 T489A probably benign Het
Dgkk T C X: 6,938,392 probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Galnt13 A T 2: 54,880,062 T289S probably benign Het
Gm16485 T C 9: 8,972,381 probably benign Het
Gm43302 A T 5: 105,280,266 V143D probably damaging Het
Gpr18 T C 14: 121,912,461 T51A probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Ighv1-24 T A 12: 114,773,080 I67F probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Myo3b A G 2: 70,245,314 E554G probably benign Het
Olfr1451 G A 19: 12,999,102 G39R probably damaging Het
Olfr819 A T 10: 129,966,712 probably null Het
Olfr888 A G 9: 38,108,881 Y60C probably damaging Het
Pclo A G 5: 14,668,995 T1049A unknown Het
Pkhd1l1 T C 15: 44,546,587 S2497P probably benign Het
Ppm1f T C 16: 16,923,883 V407A probably damaging Het
Ppox A G 1: 171,277,493 L374S probably damaging Het
Prkdc T C 16: 15,799,967 Y3221H probably benign Het
Ptprk A T 10: 28,473,043 I520F probably damaging Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3d A T 9: 21,914,908 M101K probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Tas2r114 T C 6: 131,689,268 T266A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trem3 T A 17: 48,257,927 V152D probably damaging Het
Vmn2r4 T A 3: 64,389,475 I630F possibly damaging Het
Vwa5b2 C A 16: 20,591,558 probably benign Het
Zfp518b A T 5: 38,674,112 H183Q probably damaging Het
Other mutations in Elmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Elmo3 APN 8 105308323 missense probably benign 0.22
IGL02580:Elmo3 APN 8 105308494 missense probably damaging 1.00
IGL03126:Elmo3 APN 8 105306381 missense probably damaging 1.00
IGL03349:Elmo3 APN 8 105306388 missense possibly damaging 0.95
R0119:Elmo3 UTSW 8 105309768 missense probably damaging 1.00
R0244:Elmo3 UTSW 8 105309171 missense probably benign 0.03
R1572:Elmo3 UTSW 8 105308301 missense probably benign 0.03
R1861:Elmo3 UTSW 8 105308581 missense probably damaging 1.00
R2143:Elmo3 UTSW 8 105308673 missense probably damaging 1.00
R2344:Elmo3 UTSW 8 105309161 missense probably damaging 1.00
R2920:Elmo3 UTSW 8 105308059 missense possibly damaging 0.61
R3944:Elmo3 UTSW 8 105309220 critical splice donor site probably null
R4992:Elmo3 UTSW 8 105309501 nonsense probably null
R5255:Elmo3 UTSW 8 105307353 missense probably benign 0.08
R5976:Elmo3 UTSW 8 105307647 missense probably damaging 1.00
R6340:Elmo3 UTSW 8 105306747 missense probably damaging 1.00
R6826:Elmo3 UTSW 8 105306746 missense probably damaging 1.00
R7541:Elmo3 UTSW 8 105306714 missense probably damaging 1.00
V8831:Elmo3 UTSW 8 105307061 missense probably benign 0.24
X0060:Elmo3 UTSW 8 105306013 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGGTTCTCTACTGAGCTTGG -3'
(R):5'- CATTCAGAGACCCTGTCGTC -3'

Sequencing Primer
(F):5'- CTCTACTGAGCTTGGGTGGTCC -3'
(R):5'- CTGCTGATCTTGCGGAAGAGC -3'
Posted On2015-02-19