Incidental Mutation 'R3687:Olfr819'
ID269575
Institutional Source Beutler Lab
Gene Symbol Olfr819
Ensembl Gene ENSMUSG00000094295
Gene Nameolfactory receptor 819
SynonymsGA_x6K02T2PULF-11644164-11643823, MOR265-2_p
MMRRC Submission 040683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3687 (G1)
Quality Score89
Status Not validated
Chromosome10
Chromosomal Location129963011-129967266 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 129966712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167974] [ENSMUST00000216322]
Predicted Effect probably null
Transcript: ENSMUST00000167974
SMART Domains Protein: ENSMUSP00000131761
Gene: ENSMUSG00000094295

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.1e-55 PFAM
Pfam:7tm_1 47 296 3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216322
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,852,590 V115M probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
C2cd3 C T 7: 100,435,833 P1544L probably benign Het
Cd44 G A 2: 102,901,350 probably null Het
Col10a1 A G 10: 34,395,498 T489A probably benign Het
Dgkk T C X: 6,938,392 probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Elmo3 G A 8: 105,308,836 probably null Het
Galnt13 A T 2: 54,880,062 T289S probably benign Het
Gm16485 T C 9: 8,972,381 probably benign Het
Gm43302 A T 5: 105,280,266 V143D probably damaging Het
Gpr18 T C 14: 121,912,461 T51A probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Ighv1-24 T A 12: 114,773,080 I67F probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Myo3b A G 2: 70,245,314 E554G probably benign Het
Olfr1451 G A 19: 12,999,102 G39R probably damaging Het
Olfr888 A G 9: 38,108,881 Y60C probably damaging Het
Pclo A G 5: 14,668,995 T1049A unknown Het
Pkhd1l1 T C 15: 44,546,587 S2497P probably benign Het
Ppm1f T C 16: 16,923,883 V407A probably damaging Het
Ppox A G 1: 171,277,493 L374S probably damaging Het
Prkdc T C 16: 15,799,967 Y3221H probably benign Het
Ptprk A T 10: 28,473,043 I520F probably damaging Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3d A T 9: 21,914,908 M101K probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Tas2r114 T C 6: 131,689,268 T266A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trem3 T A 17: 48,257,927 V152D probably damaging Het
Vmn2r4 T A 3: 64,389,475 I630F possibly damaging Het
Vwa5b2 C A 16: 20,591,558 probably benign Het
Zfp518b A T 5: 38,674,112 H183Q probably damaging Het
Other mutations in Olfr819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Olfr819 APN 10 129965804 missense probably damaging 1.00
R2037:Olfr819 UTSW 10 129966140 missense probably benign 0.05
R2048:Olfr819 UTSW 10 129965992 missense probably damaging 1.00
R5249:Olfr819 UTSW 10 129966209 missense probably benign 0.06
R5445:Olfr819 UTSW 10 129966289 missense probably benign 0.19
R8007:Olfr819 UTSW 10 129965875 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGAAGGTGTGGTCCAGATCAC -3'
(R):5'- GTCAACTGTAAAAGAGCTTTGTGTG -3'

Sequencing Primer
(F):5'- CACACAGATGATGGTGAGGTTTCC -3'
(R):5'- AAAAGAGCTTTGTGTGTGTTACTAG -3'
Posted On2015-02-19