Incidental Mutation 'R3687:Atp11c'
ID269598
Institutional Source Beutler Lab
Gene Symbol Atp11c
Ensembl Gene ENSMUSG00000062949
Gene NameATPase, class VI, type 11C
SynonymsIg, A330005H02Rik
MMRRC Submission 040683-MU
Accession Numbers

Genbank: NM_001001798; MGI: 1859661

Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R3687 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location60223290-60592698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60281644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 431 (Y431C)
Ref Sequence ENSEMBL: ENSMUSP00000033480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033480] [ENSMUST00000101527] [ENSMUST00000154051]
Predicted Effect probably benign
Transcript: ENSMUST00000033480
AA Change: Y431C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033480
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 5.2e-18 PFAM
Pfam:Hydrolase 403 827 1.6e-12 PFAM
Pfam:HAD 406 825 9.2e-21 PFAM
Pfam:Hydrolase_like2 467 576 1.3e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101527
AA Change: Y431C

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099066
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 1.2e-17 PFAM
Pfam:Hydrolase 403 827 1.8e-12 PFAM
Pfam:HAD 406 825 1.4e-20 PFAM
Pfam:Hydrolase_like2 467 576 3.7e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
low complexity region 1091 1105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138569
Predicted Effect probably benign
Transcript: ENSMUST00000154051
AA Change: Y431C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000119320
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 22 91 2.6e-25 PFAM
Pfam:E1-E2_ATPase 96 371 2.7e-13 PFAM
Pfam:Hydrolase 403 725 2.4e-7 PFAM
Pfam:HAD 406 825 3.4e-19 PFAM
Pfam:Cation_ATPase 467 576 8.6e-14 PFAM
Pfam:PhoLip_ATPase_C 842 1094 3.4e-71 PFAM
Meta Mutation Damage Score 0.7158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,852,590 V115M probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
C2cd3 C T 7: 100,435,833 P1544L probably benign Het
Cd44 G A 2: 102,901,350 probably null Het
Col10a1 A G 10: 34,395,498 T489A probably benign Het
Dgkk T C X: 6,938,392 probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Elmo3 G A 8: 105,308,836 probably null Het
Galnt13 A T 2: 54,880,062 T289S probably benign Het
Gm16485 T C 9: 8,972,381 probably benign Het
Gm43302 A T 5: 105,280,266 V143D probably damaging Het
Gpr18 T C 14: 121,912,461 T51A probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Ighv1-24 T A 12: 114,773,080 I67F probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Myo3b A G 2: 70,245,314 E554G probably benign Het
Olfr1451 G A 19: 12,999,102 G39R probably damaging Het
Olfr819 A T 10: 129,966,712 probably null Het
Olfr888 A G 9: 38,108,881 Y60C probably damaging Het
Pclo A G 5: 14,668,995 T1049A unknown Het
Pkhd1l1 T C 15: 44,546,587 S2497P probably benign Het
Ppm1f T C 16: 16,923,883 V407A probably damaging Het
Ppox A G 1: 171,277,493 L374S probably damaging Het
Prkdc T C 16: 15,799,967 Y3221H probably benign Het
Ptprk A T 10: 28,473,043 I520F probably damaging Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3d A T 9: 21,914,908 M101K probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Tas2r114 T C 6: 131,689,268 T266A probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trem3 T A 17: 48,257,927 V152D probably damaging Het
Vmn2r4 T A 3: 64,389,475 I630F possibly damaging Het
Vwa5b2 C A 16: 20,591,558 probably benign Het
Zfp518b A T 5: 38,674,112 H183Q probably damaging Het
Other mutations in Atp11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
18nih30a APN X 36608577 unclassified probably benign
ambrosius APN X 36608577 unclassified probably benign
IGL00578:Atp11c APN X 60240817 missense probably damaging 1.00
IGL01702:Atp11c APN X 60269903 missense probably damaging 0.96
emptyhive UTSW X 60269987 nonsense probably null
hit UTSW X nonsense
spelling UTSW X 60290036 missense probably damaging 1.00
R1551:Atp11c UTSW X 60236712 critical splice acceptor site probably null
R2134:Atp11c UTSW X 60276783 missense probably damaging 1.00
R3688:Atp11c UTSW X 60281644 missense probably benign 0.07
R4496:Atp11c UTSW X 60280744 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACCCATTGGAAAATTCGG -3'
(R):5'- GCAGTGCTCACTCTATTGTTG -3'

Sequencing Primer
(F):5'- GCACCCATTGGAAAATTCGGTATTTC -3'
(R):5'- AGTTGCTTAGCTTCACAAAATCC -3'
Posted On2015-02-19