Incidental Mutation 'R3688:Pard3b'
ID 269600
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3L, PAR3B, 1810008K04Rik, 2010002N16Rik, PAR3beta, Als2cr19, 2810455B10Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3688 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 61677983-62681443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62518728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 938 (T938A)
Ref Sequence ENSEMBL: ENSMUSP00000074837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
PDB Structure Solution structure of PDZ domain in protein XP_110852 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000046673
AA Change: T876A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: T876A

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075374
AA Change: T938A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: T938A

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094906
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147177
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,415,968 (GRCm39) I687T possibly damaging Het
A1cf T A 19: 31,888,569 (GRCm39) F100I probably damaging Het
Adam12 A T 7: 133,566,525 (GRCm39) Y308* probably null Het
Adam3 T C 8: 25,193,864 (GRCm39) T383A probably benign Het
Adcy8 T C 15: 64,743,556 (GRCm39) T351A probably damaging Het
Atp11c T C X: 59,327,004 (GRCm39) Y431C probably benign Het
Atp7b T C 8: 22,494,246 (GRCm39) H956R probably damaging Het
Bptf C A 11: 106,965,024 (GRCm39) R1275L probably benign Het
Cept1 G T 3: 106,427,331 (GRCm39) N236K probably benign Het
Col15a1 C T 4: 47,258,689 (GRCm39) T360I probably benign Het
Efcab6 G A 15: 83,755,479 (GRCm39) Q1323* probably null Het
Efl1 T A 7: 82,412,178 (GRCm39) S856T probably benign Het
Eftud2 T C 11: 102,735,027 (GRCm39) E624G probably damaging Het
Fat2 T C 11: 55,171,927 (GRCm39) T2929A probably damaging Het
Gm4884 A G 7: 40,692,910 (GRCm39) H293R possibly damaging Het
Hdac10 C T 15: 89,007,767 (GRCm39) probably null Het
Il17rd C A 14: 26,761,105 (GRCm39) N15K probably null Het
Kcnt1 C T 2: 25,784,371 (GRCm39) T258I probably damaging Het
Kif5a T G 10: 127,078,643 (GRCm39) N334T probably damaging Het
Ksr2 A G 5: 117,693,044 (GRCm39) Q164R probably damaging Het
Map4k4 T A 1: 40,024,331 (GRCm39) probably null Het
Naa80 T C 9: 107,460,549 (GRCm39) V148A possibly damaging Het
Or9a2 G T 6: 41,749,160 (GRCm39) Y24* probably null Het
Pcdhga6 T A 18: 37,841,594 (GRCm39) I438N probably damaging Het
Pfkm T A 15: 98,029,398 (GRCm39) N697K probably benign Het
Prr23a4 A T 9: 98,785,517 (GRCm39) M61L probably benign Het
Pus10 T C 11: 23,617,334 (GRCm39) F16L probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rangap1 A T 15: 81,602,963 (GRCm39) M154K possibly damaging Het
Slc25a17 A G 15: 81,211,485 (GRCm39) F177S probably benign Het
Slc34a2 G A 5: 53,222,174 (GRCm39) G289S probably benign Het
Strn4 A G 7: 16,556,506 (GRCm39) Y123C probably damaging Het
Swt1 A T 1: 151,267,240 (GRCm39) M647K probably damaging Het
Trpm5 A G 7: 142,632,193 (GRCm39) V872A probably damaging Het
Ubqln4 T C 3: 88,470,466 (GRCm39) S313P probably damaging Het
Vmn1r17 T A 6: 57,337,544 (GRCm39) T225S probably damaging Het
Vmn2r75 T A 7: 85,797,629 (GRCm39) H728L probably damaging Het
Vps33a T C 5: 123,673,274 (GRCm39) probably null Het
Vwde T A 6: 13,186,891 (GRCm39) R865S probably damaging Het
Zfp408 T A 2: 91,476,777 (GRCm39) M126L probably benign Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62,200,357 (GRCm39) missense probably damaging 0.99
IGL01363:Pard3b APN 1 62,676,799 (GRCm39) missense probably damaging 1.00
IGL01509:Pard3b APN 1 62,200,407 (GRCm39) missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62,677,021 (GRCm39) missense probably damaging 0.96
IGL01651:Pard3b APN 1 62,518,963 (GRCm39) intron probably benign
IGL01670:Pard3b APN 1 62,250,807 (GRCm39) missense probably damaging 1.00
IGL02156:Pard3b APN 1 61,807,109 (GRCm39) missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62,205,541 (GRCm39) missense probably damaging 1.00
IGL02450:Pard3b APN 1 62,571,835 (GRCm39) missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62,237,930 (GRCm39) splice site probably benign
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0060:Pard3b UTSW 1 61,678,474 (GRCm39) missense probably damaging 0.97
R0157:Pard3b UTSW 1 62,250,792 (GRCm39) missense probably damaging 0.96
R0333:Pard3b UTSW 1 62,269,371 (GRCm39) missense probably benign 0.00
R0448:Pard3b UTSW 1 62,205,628 (GRCm39) missense probably damaging 1.00
R0465:Pard3b UTSW 1 62,250,877 (GRCm39) splice site probably benign
R0497:Pard3b UTSW 1 62,479,167 (GRCm39) splice site probably null
R1264:Pard3b UTSW 1 62,203,316 (GRCm39) missense probably damaging 1.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1482:Pard3b UTSW 1 62,205,526 (GRCm39) missense probably damaging 1.00
R1554:Pard3b UTSW 1 62,677,053 (GRCm39) missense probably damaging 0.97
R1836:Pard3b UTSW 1 62,676,763 (GRCm39) missense probably benign 0.03
R2005:Pard3b UTSW 1 62,184,050 (GRCm39) missense probably benign 0.12
R2220:Pard3b UTSW 1 62,518,842 (GRCm39) nonsense probably null
R2435:Pard3b UTSW 1 62,626,897 (GRCm39) missense probably damaging 1.00
R3015:Pard3b UTSW 1 62,384,037 (GRCm39) missense probably damaging 1.00
R3712:Pard3b UTSW 1 62,383,137 (GRCm39) missense probably damaging 1.00
R3799:Pard3b UTSW 1 62,200,388 (GRCm39) missense probably benign 0.06
R3942:Pard3b UTSW 1 62,198,611 (GRCm39) missense probably damaging 1.00
R4683:Pard3b UTSW 1 62,255,675 (GRCm39) missense probably benign
R4729:Pard3b UTSW 1 62,250,843 (GRCm39) missense probably damaging 1.00
R4898:Pard3b UTSW 1 61,807,159 (GRCm39) missense probably damaging 1.00
R4981:Pard3b UTSW 1 62,383,219 (GRCm39) missense probably damaging 1.00
R5049:Pard3b UTSW 1 62,200,320 (GRCm39) missense probably benign 0.01
R5223:Pard3b UTSW 1 62,383,272 (GRCm39) missense probably damaging 1.00
R5476:Pard3b UTSW 1 62,049,565 (GRCm39) missense probably benign 0.10
R5541:Pard3b UTSW 1 61,678,502 (GRCm39) missense probably damaging 1.00
R5672:Pard3b UTSW 1 62,049,625 (GRCm39) missense probably benign 0.11
R5714:Pard3b UTSW 1 62,677,075 (GRCm39) missense probably null 0.99
R5722:Pard3b UTSW 1 62,479,160 (GRCm39) splice site probably null
R5793:Pard3b UTSW 1 61,807,132 (GRCm39) missense probably damaging 1.00
R5930:Pard3b UTSW 1 61,807,289 (GRCm39) intron probably benign
R5950:Pard3b UTSW 1 62,255,690 (GRCm39) missense probably benign 0.04
R5997:Pard3b UTSW 1 62,115,568 (GRCm39) missense probably damaging 1.00
R6646:Pard3b UTSW 1 62,200,280 (GRCm39) missense probably benign 0.32
R6720:Pard3b UTSW 1 62,198,629 (GRCm39) missense probably damaging 0.99
R6809:Pard3b UTSW 1 62,200,340 (GRCm39) missense probably damaging 1.00
R7148:Pard3b UTSW 1 62,479,191 (GRCm39) missense probably benign 0.01
R7847:Pard3b UTSW 1 62,383,093 (GRCm39) missense probably benign 0.00
R7879:Pard3b UTSW 1 62,198,670 (GRCm39) missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62,193,148 (GRCm39) missense probably damaging 1.00
R8125:Pard3b UTSW 1 61,807,143 (GRCm39) missense probably damaging 1.00
R8329:Pard3b UTSW 1 62,676,957 (GRCm39) missense probably benign 0.30
R8766:Pard3b UTSW 1 62,198,637 (GRCm39) missense probably benign 0.35
R8833:Pard3b UTSW 1 62,384,158 (GRCm39) missense probably benign 0.00
R8889:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8892:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8907:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R8909:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R9215:Pard3b UTSW 1 62,203,344 (GRCm39) missense probably damaging 1.00
R9310:Pard3b UTSW 1 62,205,528 (GRCm39) missense probably damaging 0.99
R9542:Pard3b UTSW 1 62,250,786 (GRCm39) nonsense probably null
Z1176:Pard3b UTSW 1 62,278,051 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGTATGATCCTGAGGAAACAG -3'
(R):5'- GTTGACCTTGGCATAGAGACCC -3'

Sequencing Primer
(F):5'- GGAGTGACAGCTAAGTGGCTAGC -3'
(R):5'- CTTGGCATAGAGACCCTCTAAGTG -3'
Posted On 2015-02-19