Incidental Mutation 'R3688:Vps33a'
ID269610
Institutional Source Beutler Lab
Gene Symbol Vps33a
Ensembl Gene ENSMUSG00000029434
Gene NameVPS33A CORVET/HOPS core subunit
Synonyms3830421M04Rik, bf
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3688 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123528659-123573038 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 123535211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031388] [ENSMUST00000031388] [ENSMUST00000031388]
Predicted Effect probably null
Transcript: ENSMUST00000031388
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031388
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031388
SMART Domains Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Sec1 34 592 7.2e-104 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,849 I687T possibly damaging Het
7420426K07Rik A T 9: 98,903,464 M61L probably benign Het
A1cf T A 19: 31,911,169 F100I probably damaging Het
Adam12 A T 7: 133,964,796 Y308* probably null Het
Adam3 T C 8: 24,703,848 T383A probably benign Het
Adcy8 T C 15: 64,871,707 T351A probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp7b T C 8: 22,004,230 H956R probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cept1 G T 3: 106,520,015 N236K probably benign Het
Col15a1 C T 4: 47,258,689 T360I probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Efl1 T A 7: 82,762,970 S856T probably benign Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Fat2 T C 11: 55,281,101 T2929A probably damaging Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Hdac10 C T 15: 89,123,564 probably null Het
Il17rd C A 14: 27,039,148 N15K probably null Het
Kcnt1 C T 2: 25,894,359 T258I probably damaging Het
Kif5a T G 10: 127,242,774 N334T probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Map4k4 T A 1: 39,985,171 probably null Het
Nat6 T C 9: 107,583,350 V148A possibly damaging Het
Olfr459 G T 6: 41,772,226 Y24* probably null Het
Pard3b A G 1: 62,479,569 T938A probably benign Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pfkm T A 15: 98,131,517 N697K probably benign Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Slc34a2 G A 5: 53,064,832 G289S probably benign Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Swt1 A T 1: 151,391,489 M647K probably damaging Het
Trpm5 A G 7: 143,078,456 V872A probably damaging Het
Ubqln4 T C 3: 88,563,159 S313P probably damaging Het
Vmn1r17 T A 6: 57,360,559 T225S probably damaging Het
Vmn2r75 T A 7: 86,148,421 H728L probably damaging Het
Vwde T A 6: 13,186,892 R865S probably damaging Het
Zfp408 T A 2: 91,646,432 M126L probably benign Het
Other mutations in Vps33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vps33a APN 5 123572943 missense probably benign 0.00
IGL01459:Vps33a APN 5 123535308 missense probably benign 0.08
IGL02473:Vps33a APN 5 123569571 missense probably damaging 1.00
IGL02899:Vps33a APN 5 123531176 missense probably damaging 1.00
R0498:Vps33a UTSW 5 123570961 missense probably benign 0.40
R1134:Vps33a UTSW 5 123570912 missense probably damaging 0.97
R1928:Vps33a UTSW 5 123558621 missense probably benign 0.02
R2012:Vps33a UTSW 5 123531181 splice site probably null
R2926:Vps33a UTSW 5 123569571 missense possibly damaging 0.83
R3872:Vps33a UTSW 5 123531192 missense probably benign 0.16
R4437:Vps33a UTSW 5 123531884 missense probably benign
R5153:Vps33a UTSW 5 123558628 missense probably damaging 1.00
R5396:Vps33a UTSW 5 123558630 missense probably damaging 0.98
R5686:Vps33a UTSW 5 123547001 critical splice donor site probably null
R5714:Vps33a UTSW 5 123569500 missense probably benign
R5814:Vps33a UTSW 5 123565056 missense probably damaging 1.00
R6845:Vps33a UTSW 5 123535272 missense probably benign 0.02
R7183:Vps33a UTSW 5 123535215 missense probably null 0.83
R7359:Vps33a UTSW 5 123558633 missense probably benign 0.00
R7593:Vps33a UTSW 5 123536556 missense probably benign 0.00
R7855:Vps33a UTSW 5 123570979 missense possibly damaging 0.78
R7885:Vps33a UTSW 5 123535249 missense possibly damaging 0.70
R8025:Vps33a UTSW 5 123558675 missense possibly damaging 0.76
R8139:Vps33a UTSW 5 123533952 missense probably benign 0.04
R8275:Vps33a UTSW 5 123569459 missense probably damaging 0.99
R8434:Vps33a UTSW 5 123533881 missense possibly damaging 0.74
R8845:Vps33a UTSW 5 123571475 critical splice donor site probably null
R8879:Vps33a UTSW 5 123533899 missense probably damaging 1.00
R8880:Vps33a UTSW 5 123569443 missense probably damaging 0.98
X0026:Vps33a UTSW 5 123547097 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCATGCTGCCAAGTTACGAC -3'
(R):5'- CAGAGACATCAAGTGGACTGGTTAG -3'

Sequencing Primer
(F):5'- GGAACTTTCTCTGTAGACCAGGC -3'
(R):5'- GTCTGTTCATATTCCATTTCTAGGTC -3'
Posted On2015-02-19