Mutagenetix > Incidental Mutation

Incidental Mutation 'R3688:Vps33a'

269610

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 123535211 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388] [ENSMUST00000031388] [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

probably null
Transcript: ENSMUST00000031388

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000031388

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000031388

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,267,849	I687T	possibly damaging	Het
7420426K07Rik	A	T	9: 98,903,464	M61L	probably benign	Het
A1cf	T	A	19: 31,911,169	F100I	probably damaging	Het
Adam12	A	T	7: 133,964,796	Y308*	probably null	Het
Adam3	T	C	8: 24,703,848	T383A	probably benign	Het
Adcy8	T	C	15: 64,871,707	T351A	probably damaging	Het
Atp11c	T	C	X: 60,281,644	Y431C	probably benign	Het
Atp7b	T	C	8: 22,004,230	H956R	probably damaging	Het
Bptf	C	A	11: 107,074,198	R1275L	probably benign	Het
Cept1	G	T	3: 106,520,015	N236K	probably benign	Het
Col15a1	C	T	4: 47,258,689	T360I	probably benign	Het
Efcab6	G	A	15: 83,871,278	Q1323*	probably null	Het
Efl1	T	A	7: 82,762,970	S856T	probably benign	Het
Eftud2	T	C	11: 102,844,201	E624G	probably damaging	Het
Fat2	T	C	11: 55,281,101	T2929A	probably damaging	Het
Gm4884	A	G	7: 41,043,486	H293R	possibly damaging	Het
Hdac10	C	T	15: 89,123,564		probably null	Het
Il17rd	C	A	14: 27,039,148	N15K	probably null	Het
Kcnt1	C	T	2: 25,894,359	T258I	probably damaging	Het
Kif5a	T	G	10: 127,242,774	N334T	probably damaging	Het
Ksr2	A	G	5: 117,554,979	Q164R	probably damaging	Het
Map4k4	T	A	1: 39,985,171		probably null	Het
Nat6	T	C	9: 107,583,350	V148A	possibly damaging	Het
Olfr459	G	T	6: 41,772,226	Y24*	probably null	Het
Pard3b	A	G	1: 62,479,569	T938A	probably benign	Het
Pcdhga6	T	A	18: 37,708,541	I438N	probably damaging	Het
Pfkm	T	A	15: 98,131,517	N697K	probably benign	Het
Pus10	T	C	11: 23,667,334	F16L	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rangap1	A	T	15: 81,718,762	M154K	possibly damaging	Het
Slc25a17	A	G	15: 81,327,284	F177S	probably benign	Het
Slc34a2	G	A	5: 53,064,832	G289S	probably benign	Het
Strn4	A	G	7: 16,822,581	Y123C	probably damaging	Het
Swt1	A	T	1: 151,391,489	M647K	probably damaging	Het
Trpm5	A	G	7: 143,078,456	V872A	probably damaging	Het
Ubqln4	T	C	3: 88,563,159	S313P	probably damaging	Het
Vmn1r17	T	A	6: 57,360,559	T225S	probably damaging	Het
Vmn2r75	T	A	7: 86,148,421	H728L	probably damaging	Het
Vwde	T	A	6: 13,186,892	R865S	probably damaging	Het
Zfp408	T	A	2: 91,646,432	M126L	probably benign	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GCATGCTGCCAAGTTACGAC -3'
(R):5'- CAGAGACATCAAGTGGACTGGTTAG -3'

Sequencing Primer
(F):5'- GGAACTTTCTCTGTAGACCAGGC -3'
(R):5'- GTCTGTTCATATTCCATTTCTAGGTC -3'

Posted On

2015-02-19