Incidental Mutation 'R3688:Efl1'
ID 269618
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R3688 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82412178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 856 (S856T)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
AlphaFold Q8C0D5
Predicted Effect probably benign
Transcript: ENSMUST00000039881
AA Change: S856T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: S856T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179489
AA Change: S856T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: S856T

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,415,968 (GRCm39) I687T possibly damaging Het
A1cf T A 19: 31,888,569 (GRCm39) F100I probably damaging Het
Adam12 A T 7: 133,566,525 (GRCm39) Y308* probably null Het
Adam3 T C 8: 25,193,864 (GRCm39) T383A probably benign Het
Adcy8 T C 15: 64,743,556 (GRCm39) T351A probably damaging Het
Atp11c T C X: 59,327,004 (GRCm39) Y431C probably benign Het
Atp7b T C 8: 22,494,246 (GRCm39) H956R probably damaging Het
Bptf C A 11: 106,965,024 (GRCm39) R1275L probably benign Het
Cept1 G T 3: 106,427,331 (GRCm39) N236K probably benign Het
Col15a1 C T 4: 47,258,689 (GRCm39) T360I probably benign Het
Efcab6 G A 15: 83,755,479 (GRCm39) Q1323* probably null Het
Eftud2 T C 11: 102,735,027 (GRCm39) E624G probably damaging Het
Fat2 T C 11: 55,171,927 (GRCm39) T2929A probably damaging Het
Gm4884 A G 7: 40,692,910 (GRCm39) H293R possibly damaging Het
Hdac10 C T 15: 89,007,767 (GRCm39) probably null Het
Il17rd C A 14: 26,761,105 (GRCm39) N15K probably null Het
Kcnt1 C T 2: 25,784,371 (GRCm39) T258I probably damaging Het
Kif5a T G 10: 127,078,643 (GRCm39) N334T probably damaging Het
Ksr2 A G 5: 117,693,044 (GRCm39) Q164R probably damaging Het
Map4k4 T A 1: 40,024,331 (GRCm39) probably null Het
Naa80 T C 9: 107,460,549 (GRCm39) V148A possibly damaging Het
Or9a2 G T 6: 41,749,160 (GRCm39) Y24* probably null Het
Pard3b A G 1: 62,518,728 (GRCm39) T938A probably benign Het
Pcdhga6 T A 18: 37,841,594 (GRCm39) I438N probably damaging Het
Pfkm T A 15: 98,029,398 (GRCm39) N697K probably benign Het
Prr23a4 A T 9: 98,785,517 (GRCm39) M61L probably benign Het
Pus10 T C 11: 23,617,334 (GRCm39) F16L probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rangap1 A T 15: 81,602,963 (GRCm39) M154K possibly damaging Het
Slc25a17 A G 15: 81,211,485 (GRCm39) F177S probably benign Het
Slc34a2 G A 5: 53,222,174 (GRCm39) G289S probably benign Het
Strn4 A G 7: 16,556,506 (GRCm39) Y123C probably damaging Het
Swt1 A T 1: 151,267,240 (GRCm39) M647K probably damaging Het
Trpm5 A G 7: 142,632,193 (GRCm39) V872A probably damaging Het
Ubqln4 T C 3: 88,470,466 (GRCm39) S313P probably damaging Het
Vmn1r17 T A 6: 57,337,544 (GRCm39) T225S probably damaging Het
Vmn2r75 T A 7: 85,797,629 (GRCm39) H728L probably damaging Het
Vps33a T C 5: 123,673,274 (GRCm39) probably null Het
Vwde T A 6: 13,186,891 (GRCm39) R865S probably damaging Het
Zfp408 T A 2: 91,476,777 (GRCm39) M126L probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R0684:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCCTCCTTGAACGAGGGTAG -3'
(R):5'- ACTGACCTTGGTGCTGTTTATC -3'

Sequencing Primer
(F):5'- TCCTCCTTGAACGAGGGTAGAAATAC -3'
(R):5'- GACCTTGGTGCTGTTTATCACTTGC -3'
Posted On 2015-02-19