Mutagenetix > Incidental Mutation

Incidental Mutation 'R3688:Atp7b'

269622

Institutional Source

Beutler Lab

Gene Symbol

Atp7b

Ensembl Gene

ENSMUSG00000006567

Gene Name

ATPase, Cu++ transporting, beta polypeptide

Synonyms

Atp7a, WND, Wilson protein

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.579) question?

Stock #

R3688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21992785-22060305 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22004230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 956 (H956R)

Ref Sequence

ENSEMBL: ENSMUSP00000106366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]

AlphaFold

Q64446

Predicted Effect

probably damaging
Transcript: ENSMUST00000006742
AA Change: H1071R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: H1071R

Domain	Start	End	E-Value	Type
Pfam:HMA	71	132	8.8e-14	PFAM
Pfam:HMA	156	217	6.6e-13	PFAM
Pfam:HMA	271	329	7.4e-13	PFAM
Pfam:HMA	364	425	1.1e-10	PFAM
Pfam:HMA	493	554	2.3e-14	PFAM
Pfam:HMA	569	630	3.1e-15	PFAM
transmembrane domain	656	675	N/A	INTRINSIC
Pfam:E1-E2_ATPase	770	1018	3.3e-60	PFAM
Pfam:Hydrolase	1023	1276	1.3e-67	PFAM
Pfam:HAD	1026	1273	4.6e-10	PFAM
Pfam:Hydrolase_3	1243	1308	5.1e-7	PFAM
transmembrane domain	1322	1344	N/A	INTRINSIC
low complexity region	1353	1370	N/A	INTRINSIC
low complexity region	1418	1437	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110738
AA Change: H956R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: H956R

Domain	Start	End	E-Value	Type
Pfam:HMA	59	120	1.2e-13	PFAM
Pfam:HMA	144	205	9.7e-12	PFAM
PDB:2AW0\|A	259	314	6e-6	PDB
Pfam:HMA	378	439	1.6e-13	PFAM
Pfam:HMA	454	515	1.5e-15	PFAM
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:E1-E2_ATPase	656	904	4.6e-50	PFAM
Pfam:Hydrolase	908	1161	6.6e-76	PFAM
Pfam:HAD	911	1158	1.5e-15	PFAM
Pfam:Hydrolase_3	1128	1193	8.5e-7	PFAM
transmembrane domain	1207	1229	N/A	INTRINSIC
low complexity region	1238	1255	N/A	INTRINSIC
low complexity region	1303	1322	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,267,849	I687T	possibly damaging	Het
7420426K07Rik	A	T	9: 98,903,464	M61L	probably benign	Het
A1cf	T	A	19: 31,911,169	F100I	probably damaging	Het
Adam12	A	T	7: 133,964,796	Y308*	probably null	Het
Adam3	T	C	8: 24,703,848	T383A	probably benign	Het
Adcy8	T	C	15: 64,871,707	T351A	probably damaging	Het
Atp11c	T	C	X: 60,281,644	Y431C	probably benign	Het
Bptf	C	A	11: 107,074,198	R1275L	probably benign	Het
Cept1	G	T	3: 106,520,015	N236K	probably benign	Het
Col15a1	C	T	4: 47,258,689	T360I	probably benign	Het
Efcab6	G	A	15: 83,871,278	Q1323*	probably null	Het
Efl1	T	A	7: 82,762,970	S856T	probably benign	Het
Eftud2	T	C	11: 102,844,201	E624G	probably damaging	Het
Fat2	T	C	11: 55,281,101	T2929A	probably damaging	Het
Gm4884	A	G	7: 41,043,486	H293R	possibly damaging	Het
Hdac10	C	T	15: 89,123,564		probably null	Het
Il17rd	C	A	14: 27,039,148	N15K	probably null	Het
Kcnt1	C	T	2: 25,894,359	T258I	probably damaging	Het
Kif5a	T	G	10: 127,242,774	N334T	probably damaging	Het
Ksr2	A	G	5: 117,554,979	Q164R	probably damaging	Het
Map4k4	T	A	1: 39,985,171		probably null	Het
Nat6	T	C	9: 107,583,350	V148A	possibly damaging	Het
Olfr459	G	T	6: 41,772,226	Y24*	probably null	Het
Pard3b	A	G	1: 62,479,569	T938A	probably benign	Het
Pcdhga6	T	A	18: 37,708,541	I438N	probably damaging	Het
Pfkm	T	A	15: 98,131,517	N697K	probably benign	Het
Pus10	T	C	11: 23,667,334	F16L	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rangap1	A	T	15: 81,718,762	M154K	possibly damaging	Het
Slc25a17	A	G	15: 81,327,284	F177S	probably benign	Het
Slc34a2	G	A	5: 53,064,832	G289S	probably benign	Het
Strn4	A	G	7: 16,822,581	Y123C	probably damaging	Het
Swt1	A	T	1: 151,391,489	M647K	probably damaging	Het
Trpm5	A	G	7: 143,078,456	V872A	probably damaging	Het
Ubqln4	T	C	3: 88,563,159	S313P	probably damaging	Het
Vmn1r17	T	A	6: 57,360,559	T225S	probably damaging	Het
Vmn2r75	T	A	7: 86,148,421	H728L	probably damaging	Het
Vps33a	T	C	5: 123,535,211		probably null	Het
Vwde	T	A	6: 13,186,892	R865S	probably damaging	Het
Zfp408	T	A	2: 91,646,432	M126L	probably benign	Het

Other mutations in Atp7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Atp7b	APN	8	22011098	missense	possibly damaging	0.91
IGL00981:Atp7b	APN	8	22027527	splice site	probably null
IGL01600:Atp7b	APN	8	22027525	splice site	probably null
IGL01713:Atp7b	APN	8	22028573	missense	probably damaging	1.00
IGL01778:Atp7b	APN	8	21994828	missense	probably benign	0.42
IGL01926:Atp7b	APN	8	22011781	missense	probably damaging	0.98
IGL02312:Atp7b	APN	8	21994770	missense	probably damaging	0.99
IGL02562:Atp7b	APN	8	22028085	missense	probably benign
IGL02573:Atp7b	APN	8	22022470	missense	probably benign	0.00
IGL02603:Atp7b	APN	8	21994776	missense	possibly damaging	0.88
IGL02622:Atp7b	APN	8	22028438	missense	possibly damaging	0.69
IGL02721:Atp7b	APN	8	22022477	missense	probably benign	0.00
IGL03145:Atp7b	APN	8	22018143	missense	probably damaging	1.00
daffodil	UTSW	8	21998266	missense	probably damaging	1.00
menace	UTSW	8	22022365	missense	probably damaging	0.97
PIT4131001:Atp7b	UTSW	8	21994656	missense	probably damaging	1.00
R0023:Atp7b	UTSW	8	22011073	missense	probably damaging	1.00
R0046:Atp7b	UTSW	8	22059995	missense	probably benign	0.00
R0128:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0130:Atp7b	UTSW	8	22028172	missense	possibly damaging	0.47
R0325:Atp7b	UTSW	8	22028451	missense	probably benign	0.22
R0412:Atp7b	UTSW	8	21995659	splice site	probably null
R0856:Atp7b	UTSW	8	21997631	missense	probably damaging	1.00
R0906:Atp7b	UTSW	8	22027826	missense	probably benign
R0989:Atp7b	UTSW	8	22028694	missense	possibly damaging	0.51
R1377:Atp7b	UTSW	8	22011785	missense	probably benign	0.17
R1517:Atp7b	UTSW	8	21997358	missense	probably damaging	1.00
R1521:Atp7b	UTSW	8	22027673	missense	probably damaging	0.96
R1529:Atp7b	UTSW	8	22028724	missense	possibly damaging	0.87
R1691:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R1743:Atp7b	UTSW	8	22006387	missense	probably damaging	1.00
R1815:Atp7b	UTSW	8	22011651	missense	possibly damaging	0.80
R2008:Atp7b	UTSW	8	22027980	missense	probably damaging	1.00
R2133:Atp7b	UTSW	8	22011077	missense	probably damaging	1.00
R2155:Atp7b	UTSW	8	22013584	missense	possibly damaging	0.69
R2182:Atp7b	UTSW	8	22014547	missense	probably damaging	0.99
R2256:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2257:Atp7b	UTSW	8	21998266	missense	probably damaging	1.00
R2274:Atp7b	UTSW	8	22020832	missense	probably benign	0.20
R2475:Atp7b	UTSW	8	21994776	missense	possibly damaging	0.88
R2906:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R2907:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R3421:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3422:Atp7b	UTSW	8	22028670	missense	probably damaging	1.00
R3945:Atp7b	UTSW	8	22020864	missense	probably benign	0.02
R4235:Atp7b	UTSW	8	22011023	missense	possibly damaging	0.90
R4700:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4701:Atp7b	UTSW	8	22000121	missense	probably benign	0.00
R4877:Atp7b	UTSW	8	22028601	missense	probably damaging	0.98
R4962:Atp7b	UTSW	8	22020885	missense	probably damaging	1.00
R5009:Atp7b	UTSW	8	22027698	missense	possibly damaging	0.88
R5016:Atp7b	UTSW	8	22015869	splice site	probably null
R5038:Atp7b	UTSW	8	22028456	missense	possibly damaging	0.67
R5438:Atp7b	UTSW	8	22014554	missense	probably benign
R5467:Atp7b	UTSW	8	22011554	missense	probably damaging	1.00
R5468:Atp7b	UTSW	8	22059970	critical splice donor site	probably null
R5512:Atp7b	UTSW	8	22012739	missense	probably benign	0.20
R5563:Atp7b	UTSW	8	22028714	missense	possibly damaging	0.82
R5751:Atp7b	UTSW	8	22018128	missense	probably damaging	1.00
R5773:Atp7b	UTSW	8	22027863	missense	probably benign
R5941:Atp7b	UTSW	8	21997496	missense	probably damaging	0.98
R6227:Atp7b	UTSW	8	22020825	missense	possibly damaging	0.63
R6265:Atp7b	UTSW	8	22015927	nonsense	probably null
R6290:Atp7b	UTSW	8	22020820	missense	probably damaging	1.00
R6368:Atp7b	UTSW	8	22020755	splice site	probably null
R6647:Atp7b	UTSW	8	22028478	missense	probably damaging	1.00
R6788:Atp7b	UTSW	8	22004375	missense	probably benign	0.37
R6830:Atp7b	UTSW	8	22022365	missense	probably damaging	0.97
R6886:Atp7b	UTSW	8	22028690	missense	probably benign	0.01
R6928:Atp7b	UTSW	8	21994812	missense	probably benign
R6965:Atp7b	UTSW	8	22028085	missense	probably benign
R7203:Atp7b	UTSW	8	21997335	missense	probably damaging	1.00
R7222:Atp7b	UTSW	8	22022378	nonsense	probably null
R7344:Atp7b	UTSW	8	21997499	missense	probably damaging	1.00
R7384:Atp7b	UTSW	8	22022315	missense	probably benign	0.01
R7449:Atp7b	UTSW	8	22011849	missense	probably damaging	0.98
R7451:Atp7b	UTSW	8	22014684	nonsense	probably null
R7607:Atp7b	UTSW	8	22011506	missense	probably damaging	1.00
R8140:Atp7b	UTSW	8	22028560	missense	probably damaging	1.00
R8160:Atp7b	UTSW	8	21997559	missense	probably damaging	0.98
R8349:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8421:Atp7b	UTSW	8	22028471	missense	probably benign	0.01
R8449:Atp7b	UTSW	8	22013540	missense	probably damaging	1.00
R8749:Atp7b	UTSW	8	22028318	missense	probably damaging	0.96
R8989:Atp7b	UTSW	8	22020895	missense	probably benign	0.06
R9210:Atp7b	UTSW	8	21997390	missense	probably damaging	1.00
R9353:Atp7b	UTSW	8	22027874	missense	possibly damaging	0.78
R9462:Atp7b	UTSW	8	22000144	missense	probably damaging	0.99
R9485:Atp7b	UTSW	8	22012762	missense	probably damaging	0.99
Z1176:Atp7b	UTSW	8	22028714	missense	probably benign	0.07
Z1177:Atp7b	UTSW	8	21994877	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GACTAATAACTGTGATGGCCCC -3'
(R):5'- CTGTGAAAGCTGCTTCCACG -3'

Sequencing Primer
(F):5'- TAATAACTGTGATGGCCCCACTGC -3'
(R):5'- TTCCACGCTAAGACCTGATGTGAAG -3'

Posted On

2015-02-19