Incidental Mutation 'R3688:Nat6'
ID269626
Institutional Source Beutler Lab
Gene Symbol Nat6
Ensembl Gene ENSMUSG00000079334
Gene NameN-acetyltransferase 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R3688 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107578887-107584050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107583350 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000091300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010192] [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000149638] [ENSMUST00000148440] [ENSMUST00000195725] [ENSMUST00000149487] [ENSMUST00000144392]
Predicted Effect probably benign
Transcript: ENSMUST00000010192
SMART Domains Protein: ENSMUSP00000010192
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 31 340 7.3e-101 PFAM
Pfam:IFRD_C 385 438 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093785
AA Change: V148A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334
AA Change: V148A

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000122985
AA Change: V148A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334
AA Change: V148A

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127380
AA Change: V148A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334
AA Change: V148A

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130053
AA Change: V148A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334
AA Change: V148A

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
AA Change: V49A

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334
AA Change: V49A

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000139581
AA Change: V148A

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334
AA Change: V148A

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149638
AA Change: V49A

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334
AA Change: V49A

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195725
SMART Domains Protein: ENSMUSP00000141718
Gene: ENSMUSG00000010048

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:IFRD 32 139 5.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149487
SMART Domains Protein: ENSMUSP00000117845
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 301 4.9e-103 PFAM
Pfam:Glyco_hydro_56 291 325 6.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,849 I687T possibly damaging Het
7420426K07Rik A T 9: 98,903,464 M61L probably benign Het
A1cf T A 19: 31,911,169 F100I probably damaging Het
Adam12 A T 7: 133,964,796 Y308* probably null Het
Adam3 T C 8: 24,703,848 T383A probably benign Het
Adcy8 T C 15: 64,871,707 T351A probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp7b T C 8: 22,004,230 H956R probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cept1 G T 3: 106,520,015 N236K probably benign Het
Col15a1 C T 4: 47,258,689 T360I probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Efl1 T A 7: 82,762,970 S856T probably benign Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Fat2 T C 11: 55,281,101 T2929A probably damaging Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Hdac10 C T 15: 89,123,564 probably null Het
Il17rd C A 14: 27,039,148 N15K probably null Het
Kcnt1 C T 2: 25,894,359 T258I probably damaging Het
Kif5a T G 10: 127,242,774 N334T probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Map4k4 T A 1: 39,985,171 probably null Het
Olfr459 G T 6: 41,772,226 Y24* probably null Het
Pard3b A G 1: 62,479,569 T938A probably benign Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pfkm T A 15: 98,131,517 N697K probably benign Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Slc34a2 G A 5: 53,064,832 G289S probably benign Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Swt1 A T 1: 151,391,489 M647K probably damaging Het
Trpm5 A G 7: 143,078,456 V872A probably damaging Het
Ubqln4 T C 3: 88,563,159 S313P probably damaging Het
Vmn1r17 T A 6: 57,360,559 T225S probably damaging Het
Vmn2r75 T A 7: 86,148,421 H728L probably damaging Het
Vps33a T C 5: 123,535,211 probably null Het
Vwde T A 6: 13,186,892 R865S probably damaging Het
Zfp408 T A 2: 91,646,432 M126L probably benign Het
Other mutations in Nat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02083:Nat6 APN 9 107583599 missense probably benign 0.01
R1838:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R1839:Nat6 UTSW 9 107583017 missense possibly damaging 0.49
R2877:Nat6 UTSW 9 107583168 missense possibly damaging 0.85
R2878:Nat6 UTSW 9 107583168 missense possibly damaging 0.85
R4836:Nat6 UTSW 9 107583539 missense probably damaging 1.00
R4873:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R4875:Nat6 UTSW 9 107583619 missense probably damaging 0.97
R6029:Nat6 UTSW 9 107583554 missense probably damaging 1.00
R6893:Nat6 UTSW 9 107583026 missense probably damaging 0.96
R7278:Nat6 UTSW 9 107583299 missense probably damaging 1.00
R7294:Nat6 UTSW 9 107582983 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCTTACCCTGGATCCTCAAC -3'
(R):5'- ACAGCTGGTCATGAGTGGTG -3'

Sequencing Primer
(F):5'- CAAGCTGCCTGAATTAATCCTGGAG -3'
(R):5'- TGAGGTGTAGCCGTCGGAAAC -3'
Posted On2015-02-19