Incidental Mutation 'R3688:2210408I21Rik'
ID269634
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3688 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77267849 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 687 (I687T)
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168779
AA Change: I687T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: I687T

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik A T 9: 98,903,464 M61L probably benign Het
A1cf T A 19: 31,911,169 F100I probably damaging Het
Adam12 A T 7: 133,964,796 Y308* probably null Het
Adam3 T C 8: 24,703,848 T383A probably benign Het
Adcy8 T C 15: 64,871,707 T351A probably damaging Het
Atp11c T C X: 60,281,644 Y431C probably benign Het
Atp7b T C 8: 22,004,230 H956R probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cept1 G T 3: 106,520,015 N236K probably benign Het
Col15a1 C T 4: 47,258,689 T360I probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Efl1 T A 7: 82,762,970 S856T probably benign Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Fat2 T C 11: 55,281,101 T2929A probably damaging Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Hdac10 C T 15: 89,123,564 probably null Het
Il17rd C A 14: 27,039,148 N15K probably null Het
Kcnt1 C T 2: 25,894,359 T258I probably damaging Het
Kif5a T G 10: 127,242,774 N334T probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Map4k4 T A 1: 39,985,171 probably null Het
Nat6 T C 9: 107,583,350 V148A possibly damaging Het
Olfr459 G T 6: 41,772,226 Y24* probably null Het
Pard3b A G 1: 62,479,569 T938A probably benign Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pfkm T A 15: 98,131,517 N697K probably benign Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Slc34a2 G A 5: 53,064,832 G289S probably benign Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Swt1 A T 1: 151,391,489 M647K probably damaging Het
Trpm5 A G 7: 143,078,456 V872A probably damaging Het
Ubqln4 T C 3: 88,563,159 S313P probably damaging Het
Vmn1r17 T A 6: 57,360,559 T225S probably damaging Het
Vmn2r75 T A 7: 86,148,421 H728L probably damaging Het
Vps33a T C 5: 123,535,211 probably null Het
Vwde T A 6: 13,186,892 R865S probably damaging Het
Zfp408 T A 2: 91,646,432 M126L probably benign Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
PIT4651001:2210408I21Rik UTSW 13 77259895 missense probably benign
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4387:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
R7079:2210408I21Rik UTSW 13 77254204 missense possibly damaging 0.86
R7130:2210408I21Rik UTSW 13 77269902 missense possibly damaging 0.93
R7215:2210408I21Rik UTSW 13 77323571 missense possibly damaging 0.96
R7272:2210408I21Rik UTSW 13 77323536 missense probably benign 0.00
R7331:2210408I21Rik UTSW 13 77183609 missense possibly damaging 0.53
R7561:2210408I21Rik UTSW 13 77193195 missense probably benign
R7684:2210408I21Rik UTSW 13 77612540 nonsense probably null
R7728:2210408I21Rik UTSW 13 77316477 missense possibly damaging 0.96
R7881:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R7964:2210408I21Rik UTSW 13 77323566 missense possibly damaging 0.53
R8008:2210408I21Rik UTSW 13 77281115 missense probably benign 0.28
R8024:2210408I21Rik UTSW 13 77612594 missense probably benign
R8170:2210408I21Rik UTSW 13 77263594 missense probably benign 0.06
R8201:2210408I21Rik UTSW 13 77193159 missense possibly damaging 0.72
R8255:2210408I21Rik UTSW 13 77267731 missense possibly damaging 0.71
R8296:2210408I21Rik UTSW 13 77267777 missense probably damaging 0.98
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGCTCCTTCGCCATCC -3'
(R):5'- CTAGCATGCAACTGTAAGGCAAAG -3'

Sequencing Primer
(F):5'- GCCATCCAGATGTGGCATTAC -3'
(R):5'- AGGGACTCACTCGGATCCAAG -3'
Posted On2015-02-19