Incidental Mutation 'R3688:Atp11c'
ID269644
Institutional Source Beutler Lab
Gene Symbol Atp11c
Ensembl Gene ENSMUSG00000062949
Gene NameATPase, class VI, type 11C
SynonymsIg, A330005H02Rik
Accession Numbers

Genbank: NM_001001798; MGI: 1859661

Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R3688 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location60223290-60592698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60281644 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 431 (Y431C)
Ref Sequence ENSEMBL: ENSMUSP00000033480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033480] [ENSMUST00000101527] [ENSMUST00000154051]
Predicted Effect probably benign
Transcript: ENSMUST00000033480
AA Change: Y431C

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033480
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 5.2e-18 PFAM
Pfam:Hydrolase 403 827 1.6e-12 PFAM
Pfam:HAD 406 825 9.2e-21 PFAM
Pfam:Hydrolase_like2 467 576 1.3e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101527
AA Change: Y431C

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099066
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 1.2e-17 PFAM
Pfam:Hydrolase 403 827 1.8e-12 PFAM
Pfam:HAD 406 825 1.4e-20 PFAM
Pfam:Hydrolase_like2 467 576 3.7e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
low complexity region 1091 1105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138569
Predicted Effect probably benign
Transcript: ENSMUST00000154051
AA Change: Y431C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000119320
Gene: ENSMUSG00000062949
AA Change: Y431C

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 22 91 2.6e-25 PFAM
Pfam:E1-E2_ATPase 96 371 2.7e-13 PFAM
Pfam:Hydrolase 403 725 2.4e-7 PFAM
Pfam:HAD 406 825 3.4e-19 PFAM
Pfam:Cation_ATPase 467 576 8.6e-14 PFAM
Pfam:PhoLip_ATPase_C 842 1094 3.4e-71 PFAM
Meta Mutation Damage Score 0.7158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,267,849 I687T possibly damaging Het
7420426K07Rik A T 9: 98,903,464 M61L probably benign Het
A1cf T A 19: 31,911,169 F100I probably damaging Het
Adam12 A T 7: 133,964,796 Y308* probably null Het
Adam3 T C 8: 24,703,848 T383A probably benign Het
Adcy8 T C 15: 64,871,707 T351A probably damaging Het
Atp7b T C 8: 22,004,230 H956R probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cept1 G T 3: 106,520,015 N236K probably benign Het
Col15a1 C T 4: 47,258,689 T360I probably benign Het
Efcab6 G A 15: 83,871,278 Q1323* probably null Het
Efl1 T A 7: 82,762,970 S856T probably benign Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Fat2 T C 11: 55,281,101 T2929A probably damaging Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Hdac10 C T 15: 89,123,564 probably null Het
Il17rd C A 14: 27,039,148 N15K probably null Het
Kcnt1 C T 2: 25,894,359 T258I probably damaging Het
Kif5a T G 10: 127,242,774 N334T probably damaging Het
Ksr2 A G 5: 117,554,979 Q164R probably damaging Het
Map4k4 T A 1: 39,985,171 probably null Het
Nat6 T C 9: 107,583,350 V148A possibly damaging Het
Olfr459 G T 6: 41,772,226 Y24* probably null Het
Pard3b A G 1: 62,479,569 T938A probably benign Het
Pcdhga6 T A 18: 37,708,541 I438N probably damaging Het
Pfkm T A 15: 98,131,517 N697K probably benign Het
Pus10 T C 11: 23,667,334 F16L probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rangap1 A T 15: 81,718,762 M154K possibly damaging Het
Slc25a17 A G 15: 81,327,284 F177S probably benign Het
Slc34a2 G A 5: 53,064,832 G289S probably benign Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Swt1 A T 1: 151,391,489 M647K probably damaging Het
Trpm5 A G 7: 143,078,456 V872A probably damaging Het
Ubqln4 T C 3: 88,563,159 S313P probably damaging Het
Vmn1r17 T A 6: 57,360,559 T225S probably damaging Het
Vmn2r75 T A 7: 86,148,421 H728L probably damaging Het
Vps33a T C 5: 123,535,211 probably null Het
Vwde T A 6: 13,186,892 R865S probably damaging Het
Zfp408 T A 2: 91,646,432 M126L probably benign Het
Other mutations in Atp11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
18nih30a APN X 36608577 unclassified probably benign
ambrosius APN X 36608577 unclassified probably benign
IGL00578:Atp11c APN X 60240817 missense probably damaging 1.00
IGL01702:Atp11c APN X 60269903 missense probably damaging 0.96
emptyhive UTSW X 60269987 nonsense probably null
hit UTSW X nonsense
spelling UTSW X 60290036 missense probably damaging 1.00
R1551:Atp11c UTSW X 60236712 critical splice acceptor site probably null
R2134:Atp11c UTSW X 60276783 missense probably damaging 1.00
R3687:Atp11c UTSW X 60281644 missense probably benign 0.07
R4496:Atp11c UTSW X 60280744 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACCCATTGGAAAATTCGG -3'
(R):5'- AGGCAGTGCTCACTCTATTGTTG -3'

Sequencing Primer
(F):5'- GCACCCATTGGAAAATTCGGTATTTC -3'
(R):5'- AGTTGCTTAGCTTCACAAAATCC -3'
Posted On2015-02-19