Incidental Mutation 'R3689:Mrpl44'
ID269647
Institutional Source Beutler Lab
Gene Symbol Mrpl44
Ensembl Gene ENSMUSG00000026248
Gene Namemitochondrial ribosomal protein L44
Synonyms1810030E18Rik, 5730593H20Rik
MMRRC Submission 040684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3689 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location79776018-79781445 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 79779649 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 270 (Y270*)
Ref Sequence ENSEMBL: ENSMUSP00000027464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]
Predicted Effect probably null
Transcript: ENSMUST00000027464
AA Change: Y270*
SMART Domains Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: Y270*

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
PDB:4CE4|H 67 333 1e-160 PDB
SCOP:d1jfza_ 72 224 5e-23 SMART
Blast:RIBOc 86 228 2e-90 BLAST
Blast:DSRM 237 288 6e-8 BLAST
SCOP:d1di2a_ 237 304 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143368
SMART Domains Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
Blast:WD40 145 182 6e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189176
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A C 9: 92,352,620 N60T probably damaging Het
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V419A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Sec31a T A 5: 100,382,907 D239V probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Srsf9 A G 5: 115,327,328 D7G probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in Mrpl44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Mrpl44 APN 1 79781004 missense probably benign 0.01
IGL02633:Mrpl44 APN 1 79776145 missense probably benign 0.02
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0909:Mrpl44 UTSW 1 79779653 missense probably benign 0.43
R1180:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1448:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R3690:Mrpl44 UTSW 1 79779649 nonsense probably null
R4533:Mrpl44 UTSW 1 79776254 missense possibly damaging 0.91
R4818:Mrpl44 UTSW 1 79780977 missense probably benign 0.00
R4893:Mrpl44 UTSW 1 79777865 missense probably damaging 0.97
R6178:Mrpl44 UTSW 1 79778178 missense possibly damaging 0.76
X0018:Mrpl44 UTSW 1 79778075 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CGAGCATTTTGGATTTTCAGGC -3'
(R):5'- GATAATGACCCTATCCACCCTG -3'

Sequencing Primer
(F):5'- CAGGCTGTATGTGCTTAATATGTAC -3'
(R):5'- AGGCCTCTCTATAGACAGTCTGG -3'
Posted On2015-02-19