Incidental Mutation 'R3689:Sec31a'
ID269663
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 040684-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R3689 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100382907 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 239 (D239V)
Ref Sequence ENSEMBL: ENSMUSP00000138129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect probably benign
Transcript: ENSMUST00000094578
AA Change: D669V

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: D669V

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182569
Predicted Effect probably benign
Transcript: ENSMUST00000182812
Predicted Effect probably benign
Transcript: ENSMUST00000182886
AA Change: D630V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: D630V

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182988
AA Change: D369V
Predicted Effect probably damaging
Transcript: ENSMUST00000183247
AA Change: D239V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325
AA Change: D239V

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Meta Mutation Damage Score 0.7107 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A C 9: 92,352,620 N60T probably damaging Het
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V419A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Srsf9 A G 5: 115,327,328 D7G probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 splice site probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCACGCTGAAACAAAATC -3'
(R):5'- TAGCTCATGAGGCACCACTG -3'

Sequencing Primer
(F):5'- CAGCTTTGGTTGCAAAGACAC -3'
(R):5'- TGAGGCACCACTGACGGTTTC -3'
Posted On2015-02-19