Mutagenetix > Incidental Mutations

Incidental Mutation 'R3689:Srsf9'

269664

Institutional Source

Beutler Lab

Gene Symbol

Srsf9

Ensembl Gene

ENSMUSG00000029538

Gene Name

serine/arginine-rich splicing factor 9

Synonyms

Sfrs9, 2610029M16Rik, SRp30c

MMRRC Submission

040684-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R3689 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

115327177-115333080 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115327328 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 7 (D7G)

Ref Sequence

ENSEMBL: ENSMUSP00000031513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000149510]

PDB Structure

Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000031513
AA Change: D7G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: D7G

Domain	Start	End	E-Value	Type
RRM	16	86	3.76e-19	SMART
RRM	113	179	1.19e-7	SMART
low complexity region	187	207	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144000

Predicted Effect

probably benign
Transcript: ENSMUST00000149510

SMART Domains

Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
RRM	54	115	3.04e-2	SMART
low complexity region	123	143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209604

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	A	C	9: 92,352,620	N60T	probably damaging	Het
Adcy2	A	T	13: 68,630,969	L984Q	probably damaging	Het
Atg16l1	T	C	1: 87,785,904	V427A	probably damaging	Het
Bclaf1	C	T	10: 20,325,397	T423I	possibly damaging	Het
Blm	G	C	7: 80,513,079	P175A	possibly damaging	Het
Bpifb1	A	G	2: 154,209,899	D208G	probably benign	Het
Cdc42ep1	T	C	15: 78,847,429	S25P	probably benign	Het
Cep162	G	A	9: 87,225,694	Q548*	probably null	Het
Chchd10	T	C	10: 75,936,001		probably benign	Het
Cog3	T	C	14: 75,754,438	M1V	probably null	Het
Dcx	T	C	X: 143,877,244	E268G	possibly damaging	Het
Elmsan1	C	T	12: 84,156,471	G886S	probably benign	Het
Erich2	T	C	2: 70,540,753	V419A	unknown	Het
Fam129a	A	G	1: 151,703,696		probably null	Het
Fam53c	A	G	18: 34,770,833	D386G	probably damaging	Het
Fgd2	A	G	17: 29,378,950	T620A	probably benign	Het
G930045G22Rik	A	T	6: 50,846,555		noncoding transcript	Het
Grpel1	G	A	5: 36,469,425		probably null	Het
Map3k15	T	A	X: 160,122,572	N1295K	possibly damaging	Het
Mrpl44	T	A	1: 79,779,649	Y270*	probably null	Het
Mtss1	A	G	15: 58,953,536	S272P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
N4bp1	C	T	8: 86,860,556	D585N	probably damaging	Het
Napb	T	C	2: 148,703,057		probably null	Het
Nexmif	A	T	X: 104,087,607	Y235N	probably damaging	Het
Nms	T	C	1: 38,946,994		probably benign	Het
Nsun2	A	G	13: 69,612,337	N45D	probably damaging	Het
Olfr1221	T	A	2: 89,112,042	I157L	possibly damaging	Het
Pak6	C	T	2: 118,693,440	Q359*	probably null	Het
Pcdhb12	C	T	18: 37,436,074	A91V	probably benign	Het
Pde11a	T	A	2: 76,291,166	K357I	probably damaging	Het
Piwil4	T	C	9: 14,725,963	T352A	probably damaging	Het
Sec31a	T	A	5: 100,382,907	D239V	probably damaging	Het
Slc13a4	T	C	6: 35,268,910	N600S	possibly damaging	Het
Smc1b	T	A	15: 85,117,263		probably benign	Het
Spatc1	A	T	15: 76,268,295	K42*	probably null	Het
Sprr2j-ps	A	G	3: 92,418,983	H55R	probably benign	Het
Stt3a	T	C	9: 36,759,322	Y51C	probably damaging	Het
Taf5	A	G	19: 47,078,785	K519E	probably damaging	Het
Taf7l	A	T	X: 134,464,325	I449K	probably damaging	Het
Tnk1	C	A	11: 69,855,599	D263Y	probably damaging	Het
Ttc21b	T	A	2: 66,224,144	I714F	probably benign	Het
Ttn	C	G	2: 76,799,244	W14284C	probably damaging	Het
Txn1	T	C	4: 57,950,846	D61G	probably benign	Het
Ugcg	T	C	4: 59,211,883	V83A	probably benign	Het
Ulk3	T	C	9: 57,593,794	V348A	probably benign	Het
Wdr93	A	G	7: 79,771,585	T409A	possibly damaging	Het
Wfikkn1	A	G	17: 25,878,718	C211R	probably damaging	Het
Zap70	T	C	1: 36,781,412	C563R	probably damaging	Het
Zc3h12c	C	T	9: 52,115,956	R721H	probably benign	Het
Zfp169	A	G	13: 48,506,901		probably benign	Het

Other mutations in Srsf9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Srsf9	APN	5	115332128	missense	probably damaging	1.00
R0137:Srsf9	UTSW	5	115332201	missense	possibly damaging	0.64
R0603:Srsf9	UTSW	5	115332637	missense	probably damaging	0.99
R1565:Srsf9	UTSW	5	115327370	missense	possibly damaging	0.73
R1781:Srsf9	UTSW	5	115327422	nonsense	probably null
R2942:Srsf9	UTSW	5	115332693	missense	probably damaging	1.00
R3622:Srsf9	UTSW	5	115330512	missense	probably damaging	0.98
R4492:Srsf9	UTSW	5	115332592	missense	probably damaging	1.00
R5345:Srsf9	UTSW	5	115330536	missense	probably benign	0.03
R5840:Srsf9	UTSW	5	115331465	missense	probably benign
R6355:Srsf9	UTSW	5	115327309	start codon destroyed	probably null	0.04
R7207:Srsf9	UTSW	5	115327422	nonsense	probably null
R7672:Srsf9	UTSW	5	115330560	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGCTACCCCTTTAAGATCG -3'
(R):5'- CCGATTGAAGGAAGTGACACC -3'

Sequencing Primer
(F):5'- GATCGCTTTAAAAATCCTCCGACCG -3'
(R):5'- GAATCCTCACCGCGGGTC -3'

Posted On

2015-02-19