Incidental Mutation 'R3689:Srsf9'
ID269664
Institutional Source Beutler Lab
Gene Symbol Srsf9
Ensembl Gene ENSMUSG00000029538
Gene Nameserine/arginine-rich splicing factor 9
SynonymsSfrs9, 2610029M16Rik, SRp30c
MMRRC Submission 040684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R3689 (G1)
Quality Score82
Status Validated
Chromosome5
Chromosomal Location115327177-115333080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115327328 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 7 (D7G)
Ref Sequence ENSEMBL: ENSMUSP00000031513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000149510]
PDB Structure
Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031513
AA Change: D7G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: D7G

DomainStartEndE-ValueType
RRM 16 86 3.76e-19 SMART
RRM 113 179 1.19e-7 SMART
low complexity region 187 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144000
Predicted Effect probably benign
Transcript: ENSMUST00000149510
SMART Domains Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
RRM 54 115 3.04e-2 SMART
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209604
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A C 9: 92,352,620 N60T probably damaging Het
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V419A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Sec31a T A 5: 100,382,907 D239V probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in Srsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Srsf9 APN 5 115332128 missense probably damaging 1.00
R0137:Srsf9 UTSW 5 115332201 missense possibly damaging 0.64
R0603:Srsf9 UTSW 5 115332637 missense probably damaging 0.99
R1565:Srsf9 UTSW 5 115327370 missense possibly damaging 0.73
R1781:Srsf9 UTSW 5 115327422 nonsense probably null
R2942:Srsf9 UTSW 5 115332693 missense probably damaging 1.00
R3622:Srsf9 UTSW 5 115330512 missense probably damaging 0.98
R4492:Srsf9 UTSW 5 115332592 missense probably damaging 1.00
R5345:Srsf9 UTSW 5 115330536 missense probably benign 0.03
R5840:Srsf9 UTSW 5 115331465 missense probably benign
R6355:Srsf9 UTSW 5 115327309 start codon destroyed probably null 0.04
R7207:Srsf9 UTSW 5 115327422 nonsense probably null
R7672:Srsf9 UTSW 5 115330560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGCTACCCCTTTAAGATCG -3'
(R):5'- CCGATTGAAGGAAGTGACACC -3'

Sequencing Primer
(F):5'- GATCGCTTTAAAAATCCTCCGACCG -3'
(R):5'- GAATCCTCACCGCGGGTC -3'
Posted On2015-02-19