Incidental Mutation 'R3689:Cdc42ep1'
ID269690
Institutional Source Beutler Lab
Gene Symbol Cdc42ep1
Ensembl Gene ENSMUSG00000049521
Gene NameCDC42 effector protein (Rho GTPase binding) 1
SynonymsMSE55, 1810058K22Rik, Borg5, CEP1
MMRRC Submission 040684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3689 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78842624-78850897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78847429 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 25 (S25P)
Ref Sequence ENSEMBL: ENSMUSP00000060930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044584] [ENSMUST00000059619]
Predicted Effect probably benign
Transcript: ENSMUST00000044584
SMART Domains Protein: ENSMUSP00000036598
Gene: ENSMUSG00000043501

DomainStartEndE-ValueType
GLECT 5 130 1.56e-47 SMART
Gal-bind_lectin 8 129 1.44e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059619
AA Change: S25P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060930
Gene: ENSMUSG00000049521
AA Change: S25P

DomainStartEndE-ValueType
PBD 38 72 2.55e-6 SMART
low complexity region 89 98 N/A INTRINSIC
Pfam:BORG_CEP 115 232 2.5e-21 PFAM
low complexity region 234 266 N/A INTRINSIC
low complexity region 272 291 N/A INTRINSIC
low complexity region 330 347 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
Meta Mutation Damage Score 0.0925 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC42 is a member of the Rho GTPase family that regulates multiple cellular activities, including actin polymerization. The protein encoded by this gene is a CDC42 binding protein that mediates actin cytoskeleton reorganization at the plasma membrane. This protein is secreted and is primarily found in bone marrow. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A C 9: 92,352,620 N60T probably damaging Het
Adcy2 A T 13: 68,630,969 L984Q probably damaging Het
Atg16l1 T C 1: 87,785,904 V427A probably damaging Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Blm G C 7: 80,513,079 P175A possibly damaging Het
Bpifb1 A G 2: 154,209,899 D208G probably benign Het
Cep162 G A 9: 87,225,694 Q548* probably null Het
Chchd10 T C 10: 75,936,001 probably benign Het
Cog3 T C 14: 75,754,438 M1V probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Erich2 T C 2: 70,540,753 V419A unknown Het
Fam129a A G 1: 151,703,696 probably null Het
Fam53c A G 18: 34,770,833 D386G probably damaging Het
Fgd2 A G 17: 29,378,950 T620A probably benign Het
G930045G22Rik A T 6: 50,846,555 noncoding transcript Het
Grpel1 G A 5: 36,469,425 probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Mtss1 A G 15: 58,953,536 S272P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 C T 8: 86,860,556 D585N probably damaging Het
Napb T C 2: 148,703,057 probably null Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nms T C 1: 38,946,994 probably benign Het
Nsun2 A G 13: 69,612,337 N45D probably damaging Het
Olfr1221 T A 2: 89,112,042 I157L possibly damaging Het
Pak6 C T 2: 118,693,440 Q359* probably null Het
Pcdhb12 C T 18: 37,436,074 A91V probably benign Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Sec31a T A 5: 100,382,907 D239V probably damaging Het
Slc13a4 T C 6: 35,268,910 N600S possibly damaging Het
Smc1b T A 15: 85,117,263 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Sprr2j-ps A G 3: 92,418,983 H55R probably benign Het
Srsf9 A G 5: 115,327,328 D7G probably benign Het
Stt3a T C 9: 36,759,322 Y51C probably damaging Het
Taf5 A G 19: 47,078,785 K519E probably damaging Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tnk1 C A 11: 69,855,599 D263Y probably damaging Het
Ttc21b T A 2: 66,224,144 I714F probably benign Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Txn1 T C 4: 57,950,846 D61G probably benign Het
Ugcg T C 4: 59,211,883 V83A probably benign Het
Ulk3 T C 9: 57,593,794 V348A probably benign Het
Wdr93 A G 7: 79,771,585 T409A possibly damaging Het
Wfikkn1 A G 17: 25,878,718 C211R probably damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zc3h12c C T 9: 52,115,956 R721H probably benign Het
Zfp169 A G 13: 48,506,901 probably benign Het
Other mutations in Cdc42ep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Cdc42ep1 UTSW 15 78849680 missense possibly damaging 0.83
R2111:Cdc42ep1 UTSW 15 78847492 missense probably damaging 1.00
R3690:Cdc42ep1 UTSW 15 78847429 missense probably benign 0.03
R4456:Cdc42ep1 UTSW 15 78849891 missense possibly damaging 0.72
R5714:Cdc42ep1 UTSW 15 78849777 missense possibly damaging 0.93
R6374:Cdc42ep1 UTSW 15 78847449 missense probably damaging 1.00
R7944:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7945:Cdc42ep1 UTSW 15 78847773 missense possibly damaging 0.94
R7995:Cdc42ep1 UTSW 15 78847496 missense probably damaging 1.00
R8010:Cdc42ep1 UTSW 15 78847799 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AAAGTCAAGGGTCGCCTTGTG -3'
(R):5'- GAACCTGTTGGAGCTTCCTG -3'

Sequencing Primer
(F):5'- TCCGCCATCTTCATTGAGAGGAAG -3'
(R):5'- TGGCCAGGAAACTTCGGG -3'
Posted On2015-02-19