Incidental Mutation 'R3690:Zap70'
ID269703
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission 040685-MU
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36781412 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 563 (C563R)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: C563R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: C563R

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Meta Mutation Damage Score 0.9708 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr294 G A 7: 86,616,478 P56S probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R6825:Zap70 UTSW 1 36778390 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36771181 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGCCAGAGTGCATCAACTTTC -3'
(R):5'- TGTGACTCTGTGAGTGGAATAC -3'

Sequencing Primer
(F):5'- CCAGAGTGCATCAACTTTCGGAAG -3'
(R):5'- TGACTCTGTGAGTGGAATACTAAGG -3'
Posted On2015-02-19